Previous: >>514364927Day: 1,284 – Daily assessment: https://isw.pub/UkraineConflictUpdatesISW▶Latest>Former Vice Spokesman of the Ukrainian Parliament, Andriy Parubiy, was murdered by rusniggers today. >a main process unit at Krasnodar refinery took a direct hit from a drone, suffering severe damage>Syzran refinery also appeared to be on fire again>Hungary bans Magyar (Robert Bovdi - who led attack on Friendship oil pipeline) from entering Hungary and Schengen area, Magyar tells Hungarian FM to get fucked>Two zigger refineries exploded: Afipsky and Kuybushevsky. Total refining capacity is down 21% just in the last two weeks.>Z-Blogger Paratrooper's Diary: "The situation in this area is very difficult. The enemy has become more active, and our troops must regroup somewhere and abandon their positions.>The situation today and yesterday is extremely difficult.>425th Assault Skala regiment entered the western Novoekonomichine town neighborhood. In Pokrovsky direction.>3rd Army Corps and GUR special forces in Novomykhailivka (Lyman direction)>Volodymyrivka has been liberated>Mykhailivka has been liberated>Ukraine has now taken over the majority of Vovchansk, Kharkiv>Romanov reports that the AFU has entered the settlement of Myrne in Donetsk region. They blame the situation on false reports from the 5th Separate Motor Rifle Brigade, which allegedly claimed control of areas it did not actually hold—leaving gaps that allowed Ukrainian units to advance.▶Telegramhttps://rentry.org/telosint2023https://t.me/ukr_pics▶Intelhttps://t.me/DeepStateENhttps://odin.tradoc.army.mil/WEG (equipment explorer)https://ukr.warspotting.net (visually confirmed losses)▶Mapshttps://deepstatemap.live/enhttps://liveuamap.com/en▶DISPOSABLE SOLDIER (diary of a RU mobik)TOUR 1: files.catbox.moe/34fuhc.txtTOUR 2: files.catbox.moe/uj2wut.txtTOUR 3: files.catbox.moe/hmyd98.txtTOUR 4: files.catbox.moe/cdenxe.txt
Holy fuck this general is dead
14:1
who is this man who keeps discrediting vladimir vladimirovich putin on a regular basis?
>>514374091Germany without cheap Russian gas is deindustrializig> Germany’s autos industry, one of the European country’s largest sectors, has seen job cuts of close to 7% of the workforce, or around 51,500 positions>German industry amounted to around 114,000 in the 12 months to June 30 this year>almost half the cuts were incurred by the autos sectorhttps://www.cnbc.com/2025/08/26/german-autos-sector-slashes-jobs-as-economic-woes-bite.html?msockid=052dc6fe07376a7e2d5cd0a606336b57>>514374434Since the last six to seven months
>>514374407you sound very brown
>>5143744507:1
So true my Muttgoy anon we should aspire to be like Russia a 100% white homogeneous white european nation. You take a walk through Moscow and another through Berlin what do you notice?
>>514374458A failed clone gone rogue.
>>514374515You can't even quote your own metodichka properly.
>>514373719The front is moving but it's still slow. This month the Russians advanced 447 km^2 which is 0.07% of Ukraine according to Deepstate. Again most of this is in Donetsk oblast but slightly less so than previous months.They're pushing toward Lyman and then to Sloviansk from the north.The Sumy axis remains dead in the water and ziggers are in retreat there.>>514373820They've just banned petrol exports lad. So they're hammering their already crippled budget. And this budget will also be expected to stretch and cover the cost of repair which will be orders of magnitude than the cost of the drone strike for Ukraine.>the shortage is only affecting the far reaches of RussiaNo. What is inflation?
It took Russia 1010 days to take less than 1% of Ukrainian territory.
>>514374607Slavic People 15:0 (JEW)Another jew holodomore
>>514374607That ratio is one between Russian artillery and Ukrainian artillery. Ukraine can cope about drones all they want but artillery is still the kind of battle.
>>514374480>Germany without cheap Russian gas is deindustrializigGas is cheap since 2023. Where have you been?>Germany is ... deindustrialisingNo you're wrong
>>514374668Who occupies the southeastern oblasts?
514374698holy outdated protocol.any opinions on bandera
>>514374697>angry monkey noisesYawn.
>>514374698>artillery is still the kind of battle.Why not cavalry?
>>514374765Show flag jew
>>514374750>only 0.84% agricultureGotta pump those numbers up, the spargel must flow
>>514374782Ukrainians emphasizes drones and losing land. Russia emphasizes artillery and is gaining land. Not much else to say.
>>514374698Artillery is a retired cope. Most casualties on both sides are inflicted by drones and it has been the case for many months now. But I understand that it's your first day on the shill farm and you're only now learning how to find Ukraine on the map.
>>51437486614:1Nothing much else to say
>>514374758leptospirosis and aids apparently
Lmao at hohols who thought Russia wanted any territory in the first place.
>>514374758Cope.>>514374815I have explicit orders from my CIA rabbi to use a memeflag.
>>514374907Who owns Kursk? Adiivka? Mariupol? Melitopol?
>>514374907>Slavic People 15:0 (JEW)
514374977Putin owns them and all slaves living on these lands.
>>514374977>2025>Who owns Kursk?14:1
>>514374866>gaining landWW1 France-German situation was considered as stalemate, and germans gained land about three times faster than russians have
>>514374958Romania is next after Ukraine. The Transnistrian military has been conducting joint operations with their Russia counterparts to prepare for an invasion of Romania once the Kherson-Odessa landbridge has been secured.
>>514374958wow, imagine sending so many rusnigs to die for absolutly nothing
>>514375070I don't think threatening everyone around you with "you are next" when you are losing 14:1 is a good idea, but you do you.
>>514374907Brutal. That's one of the roads to Pokrovsk right?
>>514375070So true!
>>514375070
>>514375031A population can be recovered, but land is a zero-sum resource.
>>514375145Yes. Road of death but instead of proper vehicles we have pidors on bikes.
>>514375192>but land is a zero-sum resource.Who owns Kherson?
>>514375194You have been brainwashed by the jew zelenskiy and his tv show: serfdom of the people
>>514375192It's literally the opposite nigger. Land can be traded back and forth, but dead people don't come back to life
>>514375070you sound very brown. also your understanding of anything seems very shallow
>>514375233Is it israel?
>>514375192>A population can be recoveredpidor, recovered by who, tajiks and indians? like in leningrad after ww2 and mariupol today? yeah sure
>>514375260>>514375340You can stop trying, rabbi.
>>514375176oh, also i have one thing from austro-hungary: a 1915 golden ducat
>>514375342What do you think jew oligarchs that run the urkayine will do population wise. Indians are quite popular global serfs>>514375397You have been brainwashed, and have me confessed by kike of kiev. Do you really have a city in the ukrayine that has all hebrew signs?
>>514375070>next>He thinks russia will be capable of attacking anyone after the complete beating that was in Ukraine lol, hold your breath then
>>514375473*confused
No rabbi, no more (You)'s.
>>514375307It's a jeet, he believes in reincarnation>I meatwave, I die, I meatwave again
>>514374325>Former Vice Spokesman of the Ukrainian Parliament, Andriy Parubiy, was murdered by rusniggers today. no other possible suspects only ziggers?
>>514375535he's a schizo tranny, so his oppinion is worthless
>>514375192This is the logic of a feudal warlord who sees people as cattle. A modern nation's most valuable resource is its human capital: its skilled workers, its soldiers, its culture. A population is not a number that can be "recovered" once you have slaughtered its men and created a demographic crater that will last for generations.Land without a skilled population to make it productive is not a resource. It is a worthless, depopulated, mine-infested liability. Russia is trading its only irreplaceable asset for ruined real estate. This is the single most inefficient act of national suicide in modern history.
>>514375643Lol, bro. Cattle is exact transition for goyim, right?
>>514375641pale of settlement jewing
Parubiy be like>electroscooters lololol>AAAAACK
>>514375120Heh, I imagined it and I like it
>>514375535>Slavic People 15:0 (JEW)Truth shall set you free
>>514375761Yeah, probably explains why jewtin shelomow thinks russoids as cattle
>>514375943What does kike of kiev think of his golemn?
>>514375826hohol glowniggers recently put a high ranking fsb general into a (probably permanent) coma and had his hands blown off
>>514375568This is really pretty>>514374992I've been worrying about this. Ziggeria's owners are all jews after they bought up the industry in the 90s, and Ukraine's leader is a jew. Jews famously conspire across nations and ethnicities. They could be another case of jews genociding christian Europeans.
>>514375966Considering 14:1, probably more than jewtin
>>514376020Slavic People 15:0 (JEW)
>>514376005Tell me more about the jews running the ukrayine and eu. Thank you
>>514375761A scholar knows 'goyim' means 'nations.' The Kremlin's word for its soldiers is 'myaso'—meat. Your obsession is with the wrong butchers.
>>514376132>A scholarLol, please tell me about you genetics?
Just a friendly reminder - kill everyone who says he is ruzzian.
>>514376225Mask is really coming off these days. The full palestinian treatment for Russian goyim
>>514376210NTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAA
>>514375192Hehe, I love how retarded malthusianists are
what Exactly is a russian?
>>514376510What happens with dead hohol genes, do you replace them with indians? I hear orban really likes indians
>>514375192And by the way, no, you cannot recover people with a 1.4 tfr, zigtard
>>514376405Would you mind telling me the truth about your ethnicity?
What are russniggers and norkgooks tradraping each other for ?
>>514376546A delusion.
>>514376628You must first define your terms. Are you asking for a genetic, linguistic, cultural, or political definition? Each of these has a different answer.
Aleksin Chemical Plant in Russia’s Tula region status?
>>514376546A body dysphoria, akin to transgenderism.
>>514376596I don't know, do you have a plan on how to replace dead russians? I keep repeating myself how tragic this war is, but keep gloating, you're digging your own grave together with your enemy's.
>>514375895it was more of a statement regarding rusnigger nation wide spinelessness.
>>514376272I don't believe this Did you crop the rt logo ?
>>514375070>Transnistrian military
>>514375070This literally made my morning drink shoot out of my nose!OMFG the delusion is hilarious! Russia is done. Trump doesn't have to do shit but sit back and keep supplying weapons to Ukraine that the UK/EU pay the US for. Trump doesn't mind Putin stalling while he digs his own grave.What's the destroyed Russian refinery tally this morning? Still at 21%?The Flamingos haven't even flown yet!
>>514376738Genetic
>>514374698The artillery ratio is 1.2:1 right now. Artillery is practically nonexistent on either side.>b-but my endless depots!Gone. Reduced to atoms. Check the satellite images if you don't believe me
>>514376777How do you replace dead hohols and whores that left?
>>514376854to be fair he got probably a mail with a script where he has to bring up transnystria even though he has no idea what it is. that's why american ziggers never cease to both amaze and frustrate me.
>>514376869To a boomer a zog war is entertaining as nfl niggers
>>514376885The genetic answer depends on the marker.Maternally, the mtDNA haplogroup is H5, common across Eastern Europe. Paternally, the Y-DNA haplogroup is R1a-Z282, the dominant East Slavic marker.However, this is a simplified view. Further analysis shows significant admixture from the J2a-M410 clade, indicating Pontic Steppe or North Caucasus ancestral origins consistent with Cossack ethnogenesis.A single haplogroup is a poor proxy for the complex genetic history of the region. Your question is fundamentally flawed.
>>514375641oof, this explains a lot
>>514376405you ought to add second complementary string tho. also nice that you started with NTA
>>514376960Beigie, I'm sorry you don't understand plain english, but try to calm down
>>514377133Hohol ai why is my question flawed?
>>514376546A woke mind virus.
>>514376546a mistake
>>514377257Please explain the cigan method for demographic question. I hear orban cigan loves indians
>>514377273Your question is flawed because it assumes a 19th-century definition of ethnicity. You are asking for a simple biological answer to a complex sociological question.A peasant in 1800s Poltava did not see himself as 'genetically' Ukrainian or Russian. He was Orthodox, spoke a local dialect, and owed loyalty to a distant Tsar.The modern identities of 'Russian' and 'Ukrainian' are political projects, not genetic destinies. They are defined by shared culture, language, and, most importantly, by a choice of political future. This war is the final, bloody divorce between those two projects. Your obsession with genetics is a primitive attempt to deny the political reality of that choice.
>>514377454What jew ai is this?
What did Russians do to make Finns so buck broken by them? They’re pretty much so the only lads left on the Ukraine can still win train.
>>514377519>Buckbroken by a thorough response>Must be an LLMPicrelated.
>>514377542>What did Russians doMaybe invaded them and stole their land?>They’re pretty much so the only ladsYou made it up.
>>514376942>The artillery ratio is 1.2:1 right now. Artillery is practically nonexistent on either side.I'm gonna need proofs for this. I thought Russians were able to spam millions of Nork and Iranian shells nonstop. Norks alone have supplied 12M+ 152mm shellshttps://stories.opensourcecentre.org/brothers-in-arms/https://www.reuters.com/graphics/UKRAINE-CRISIS/NORTHKOREA-RUSSIA/lgvdxqjwbvo/
>>514377064Only 53, not a Boomer.One of my closest friends is over in Ukraine for a month on leave from his job to help re-build homes. He has a daughter that he adopted from Ukraine 20+ years ago. One of my closest customers is also from Lviv. One of my closest co-workers is Ukrainian ancestry.Even though I'm a Texan and voted for Trump 3x, I've supported Ukraine 100% from Day one of Putin's reign of rape, murder and terror.I'm also more of a College Football guy, Hook 'Em HORNS!!!!
>>514377763Yeah, but when one of the Nork shells fails, it takes out the arty piece and some of the artillery men. Isn't the failure rate ridiculous? Hard for starving slaves to make good arty shells.
>sign up for military benefits>you will get compensation >pinky promise >oh your son is dead now? fuck you worthless shit
>>514376546A Russian is a human, who identifies with a particular ethnic or national community. As a human, they are capable of good and evil, destruction and production, love and hate. As humans are heavily influenced by their communities, Russians as a whole exhibit a certain collectivist atomization. They are usually at the same time extremely individualistic, and self-serving, while also subscribing to the idea of russian nationalism, which is contradictory behaviour. Russians in the past also created works of art, have contributed to human culture as a whole and have been subject to national humiliations and genocides. So it is complicated.
>>514377720Well it is a ai, its very obviously so
>>514377954
>>514378082...because you're disliking the argument I'm presenting and unable to counter it, it must be an LLM, yes.
Politico reports that European leaders are floating a 40 km Ukraine-Russia buffer zone as part of a ceasefire plan—an idea Moscow supports but Ukraine hasn’t endorsed. The proposal, which could involve up to 60,000 peacekeeping troops, raises concerns over territorial concessions, NATO readiness, and security gaps along Russia’s border.https://x.com/NOELreports/status/1961318557943296130
>>514376000So, hyhyls whack a high ranking FSB glowie and ziggers whack a washed-up politician nobody cares about anymore? I'm not buying it.Probably some local mafia dealings.
>>514378225aaaah my eyes!
Turkish Foreign Minister Hakan Fidan revealed that Russia no longer insists on controlling all four annexed Ukrainian regions. Instead, Moscow is now seeking to hold the current front line in Zaporizhzhia and retain 25–30% of Donetsk. Fidan also confirmed that strategic adjustments are underway, and any territorial loss could be balanced through international security guarantees.https://x.com/NOELreports/status/1961321300162457769
>>514378225Don't you have a phone? Just aim it at the computer screen and select google lens->translate. It says due to certain conditions, you are not allowed to bring cotton, wool and faggots at the cafe.
Russia’s overnight missile strike on August 28 killed 23 people in Kyiv, President Zelensky reported. The fate of 8 individuals remains unknown, and 53 others were injured.https://x.com/NOELreports/status/1961322961647829106https://litter.catbox.moe/soh780j955wfm0he.mp4
>>514378536English speaking board.
The European Commission is working on a mechanism to transfer nearly €200 billion in frozen Russian assets into a special fund dedicated to Ukraine’s reconstruction after the war, according to Politico.https://x.com/NOELreports/status/1961323570270711882
>>514378076Interesting you mention their alleged victimization to genocide rather than the fact that russians were predominantly the perpetrators of genocide.The last time muskovites and pidorsburgers were properly genocided was around the time of the huns and even there they quickly acted as quislings of the golden horde.Thereafter russians consistently were the ones perpetrating genocide, not suffering genocide themselves.Even today russians are committing genocide in Ukraine, in Georgia, in Belarus and much of the far east is basically gone, culturally - only an empty and impoverished pidor shell remains.
>>514377760Most people don’t give a shit anymore. Even the Ukrainians that have been given refuge don’t care anymore, they’re staying and never going back home most of them. Only people who actually seem to give a shit now are Finns to a deranged extent, and it’s way more than simply being invaded. Russians seems to have brain fucked them at a genetic level, it’s almost impressive.
>>514376546A miserable pile of secrets.
On the night of August 28, Ukraine’s military intelligence struck a high-value Russian target in occupied Crimea—a 91N6E radar system, part of the S-400 “Triumf” air defense complex.https://x.com/NOELreports/status/1961324165698326540https://litter.catbox.moe/gen4ujh0ddh13fbz.mp4
Russia’s Ust-Luga oil export terminal will run at about half capacity in September—around 350,000 barrels per day—after Ukrainian drone strikes damaged key pipeline infrastructure, Reuters reports. The disruption is forcing oil flows to be diverted to Primorsk and Novorossiisk.https://x.com/NOELreports/status/1961330007344578891
>>514377720Jew ai is transwomen a women?
The Economist reports details on Ukraine’s new “Flamingo” cruise missile: developed in just 9 months after the U.S. declined to provide Tomahawks, it is now in serial production. Built 90% domestically with a fiberglass body and AI-25 engine, production runs at 1 missile per day, expected to rise to 7 daily by October. Cost is under €1M per unit. Some see it as overhyped, others believe it could break through Russian air defenses.https://x.com/NOELreports/status/1961330634963439871
>>514378581I'm just saying, getting familiar with new and accessible technologies can only be positive.
Ukrainian forces carried out an airstrike on a Russian position in Tyotkino, Kursk region.https://x.com/NOELreports/status/1961353908216901803https://litter.catbox.moe/f3cx9nes79hnkhbq.mp4
Belgium will deliver F-16 fighter jets to Ukraine as soon as possible and provide an additional €100 million in military aid, the country’s defense minister announced.https://x.com/NOELreports/status/1961360076419072464
>>514378067damn they dont even turn into Ladas anymore??
>>514378784>TetKino
Same old repetative story. Russia’s Foreign Ministry stated that any peace deal must include Ukraine’s demilitarization, “denazification,” neutral non-aligned and non-nuclear status, as well as recognition of territorial “realities” and guarantees for the Russian language and Russian-speaking population.https://x.com/NOELreports/status/1961372977179611341
a fire broke out at known Russian air defense positions near Cape Tarkhankut in occupied Crimea, monitoring group Crimean Wind reports. NASA FIRMS detected fire spots near Olenivka village. Earlier, Russian channels reported UAV threats in the area. Russia’s MoD claims 19 drones were downed over Crimea and the Black Sea overnight.https://x.com/NOELreports/status/1961374192772751871
>>514378823>belgiumIt's never enough thoughbeitnuthin personnel
>my corward country doesn't condem vatnigger shit on a daily basisI hate it bros
Ukrainian forces struck a fuel facility in Russia’s Bryansk region, hitting a linear production station near Naitopovychi that pumps up to 10.5 million tons of diesel annually, including for Russian military needs.https://x.com/NOELreports/status/1961374538563727625https://litter.catbox.moe/77lyx03p661ap1x3.mp4
>>514378742German Defense Minister Boris Pistorius said Berlin is “very satisfied” with how cooperation with Kyiv is progressing on the production of long-range weapons in Ukraine, financed by Germany.https://x.com/NOELreports/status/1961393053865828383
>A National Military Memorial Cemetery has been opened near Kyiv. President Zelensky arrived there on the first ride of a newly launched special bus service, which will operate free of charge on a permanent basis.https://x.com/NOELreports/status/1961392614059479269https://litter.catbox.moe/q0o9c1vf43u4c2nj.mp4
Are puccian boys good at sucking dick ?Asking for a fren
>>514377959When is tejas turning democrat?
>>514378613Russians have at times been perpetrators and also victims of genocide, and this isn't specific to them. They did inflict a genocidal starvation campaign, the Holodomor on Ukrainians, and as a less known fact, the Kazakhs also, who even died at a higher rate than Ukrainians. After that, Russians colonized the parts of Ukraine and Kazakhstan where the local population has been killed. This is the reason why the Donbas and Northern Kazakhstan today has a large russian minority. At the same time, Russians, alongside with Ukrainians and Belarussians, were the victims of a genocide perpetrated by the German army during WW2 the same way, mainly through starvation and economic exploitation.Humans are complex. They can be victims and perpetrators, as individuals and groups at the same time. This is true for Germans, Russians, Hungarians, Jews, everyone.
The Kuybyshev oil refinery in Samara has halted operations after a massive Ukrainian drone strike, ASTRA reports. At least 29 UAVs targeted the facility, causing seven fires and injuring one worker. Key units, including crude processing, hydrogen production, pipelines, and fuel tanks, were hit.https://x.com/NOELreports/status/1961393750195700052
President Zelensky warned that Russia is amassing significant airborne forces in the Zaporizhzhia region, calling the situation very dangerous. He outlined three key blocks of Ukraine’s security guarantees: maintaining a strong army with steady arms supplies, NATO commitments for immediate support in case of renewed aggression, and sustained sanctions on Russia with frozen assets used for Ukraine’s recovery.https://x.com/NOELreports/status/1961407388486905893
>>514379060Jew flag has a single jew died for zelenskiy?
>>514378489Zelensky dismissed EU proposals for a 40–100 km buffer zone, saying modern warfare makes such concepts meaningless since heavy weapons and drones already strike at long range. He added that if Russia wants more distance, it can retreat deeper into occupied territories.https://x.com/NOELreports/status/1961408231248392317
>>514379101By Russians you mean jew revolution of 1918, that also starved Russian goyim?
>>514378742Ukraine’s National Anti-Corruption Bureau has launched an investigation into Fire Point, the producer of the new long-range Flamingo missile and Fire Point drones, Kyiv Independent reports. Detectives are examining whether the company inflated component costs or overstated drone deliveries to the Defense Ministry.https://x.com/NOELreports/status/1961416718569349489
>>514375032This war will probably end like in 1918 with the central powers
>>514379213Wasn't talking to you
>>514379099Tejas is a Bharat sixth-generation aircraft saaaaaaaaaaaaar
>>514379213 1917, and there were two actually, one against the tsar and the war, and the second is where the kike commies took overCommander of Ukraine’s Unmanned Systems Forces Robert “Magyar” Brovdi confirmed that Ukrainian missile and drone units struck the 8-N Naitopovychi linear production dispatch station in Russia’s Bryansk region on August 29. Operated by Transneft, the facility pumps fuel through key pipelines to the Russian military. The strike has significantly disrupted fuel logistics.https://x.com/NOELreports/status/1961419343503188447
>>514379101Germany under Hitler never made it to russia (mosquow, pidorsburg) properrussians readily sent Ukrainians to die en masse and the churkoid contingents of their horde army would rape even those that were fleeing eastwards after escaping German concentration campsPiss on the grave of the unknown rapist today
France and Germany will provide Ukraine with additional air defense systems and deepen security cooperation, according to a joint statement following the Franco-German ministerial summit attended by Chancellor Friedrich Merz and President Emmanuel Macron, The Guardian reports.https://x.com/NOELreports/status/1961480557298139612
EU countries have agreed to deploy military instructors inside Ukraine, EU foreign policy chief Kaja Kallas announced. She said there is broad support for expanding the EUMAM mission to provide training and advisory assistance in Ukraine once a ceasefire is in place.https://x.com/NOELreports/status/1961480835653070913
>>514379344No doubt, pajeets are now most favorite zog serf.
Denmark will spend about €1.4 billion this year on funding weapons production for Ukraine by Ukrainian defense companies, Defense Minister Troels Lund Poulsen said. He praised the “Danish model,” noting it is faster and more cost-effective than European producers, and urged more allies to join the initiative. Last year, Denmark placed €600M in such contracts.https://x.com/NOELreports/status/1961483881020023261
worthless thread
>>514379299Cigan version of do no redeem saar
>>514379060President Zelensky announced that the first burial ceremony has taken place at the newly opened National Military Memorial Cemetery. Today, he visited the cemetery.Glory to the heroeshttps://x.com/NOELreports/status/1961486303989572038https://litter.catbox.moe/c6yuz8b1924to506.mp4>part 1
>>514379362Almost the entirity of Fall Blau was fought on Russian SFSR ground. While proportionally to their population more Ukrainians and Belarussians died than Russians, Russian (citizens of the russian sfsr) civilian dead still accounted for the plurality of deaths in the soviet union.
>>514379588>President Zelensky announced that the first burial ceremony has taken place at the newly opened National Military Memorial Cemetery. Today, he visited the cemetery.>Glory to the heroespart 2
Scum government. Hungary refused to back an EU statement condemning Russia’s massive August 28 strike on Kyiv and other Ukrainian cities, which killed dozens of civilians. The declaration was supported by all 26 other EU member states.https://x.com/NOELreports/status/1961486786569416944https://litter.catbox.moe/fs9z1z1phczdv0iz.jpg
>>514379588At 1:10 is that a jew or a mudslime?
>>514379596>Fall BlauKGB fake news cumrade!
>>514374458Slavic Honesty is my favorite oxymoron
>>514378721Is Shelomov a Halacha Jew?
Russian forces launched new mechanized assaults near Mala Tokmachka, Zaporizhzia region, using 2 tanks and 4 BMPs—all of which were hit or destroyed. Infantry scattered after losses but was also targeted by Ukrainian fire. One Russian soldier was captured on the highway.https://x.com/NOELreports/status/1961487713116246044video 1https://litter.catbox.moe/yvjjx1bzjit8n0bj.mp4video 2https://litter.catbox.moe/1rop557wtdwpebn4.mp4
>>514379750Why would it be? The German push to Stalingrad and the Caucasus was the last real chance for Germany to win the war against the Soviet Union.
>>514379842>>514374325>Russian forces launched new mechanized assaults near Mala Tokmachka, Zaporizhzia region, using 2 tanks and 4 BMPs—all of which were hit or destroyed. Infantry scattered after losses but was also targeted by Ukrainian fire. One Russian soldier was captured on the highway.video 1>>514379730 shhh Fico no russnigger oil for you, KIKE
>>514379842>Russian forces launched new mechanized assaults near Mala Tokmachka, Zaporizhzia region, using 2 tanks and 4 BMPs—all of which were hit or destroyed. Infantry scattered after losses but was also targeted by Ukrainian fire. One Russian soldier was captured on the highway.video 2
>>514379877That's just KGB propaganda from the soviet state department, yuo are of so brainwashed!
>>514374325 BOOMA massive detonation of a concealed Russian field depot storing TM-62 anti-tank mines occurred after it was struck by a Ukrainian FPV drone.https://x.com/NOELreports/status/1961488000375836834https://litter.catbox.moe/eaipqxid3bwvl7mp.mp4
>>514377763Shells don't matter so much when you don't have cannons to shoot them
SitRep - 29/08/25 - The Kuybyshev oil refinery has halted operationsAn overview of the daily events in Russia's invasion of Ukraine. The Kuybyshev oil refinery in Samara has halted operations after a massive Ukrainian drone strike.https://x.com/NOELreports/status/1961686496991166571
>>514379596>pluralityThey have stolen many things over the 5 centuries of their existence and "Russian" is one of them.
>>514374325Russian losses per 30/08/25 reported by the Ukrainian General Staff+850 men+6 tanks+19 AFVs+47 artillery+316 UAVshttps://x.com/NOELreports/status/1961687400196800886
>>514379777The absence of primary documents (e.g., birth records, synagogue affiliations, or rabbinical rulings) in these discussions makes such claims speculative at best.Test his dna. Now please Jew ai is transwomen a women?
Yet another large-scale air attack was reported by Ukraine's Air Force.Shot down:510/537 Shahed and other type drones6/8 Iskander-M/KN-23 ballistic missiles32/37 various types cruise missilesThe amount of intercepted ballistic- and cruise missiles is increasing.https://x.com/NOELreports/status/1961687973864374422
>>514379977Is there a list of dead soldiers by religion?
>>514374325The U.S. State Department has approved two separate arms deals for Ukraine worth $330 million: $179.1M for sustaining Patriot air defense systems and $150M for expanding satellite communication services for Starlink terminals.https://x.com/NOELreports/status/1961689827939688545https://litter.catbox.moe/o6xjpfqcs2h835b5.jpg
>>514380174I don't disagree with that.
>>514380261
>>514380261You apply a modern, secular standard (genetics) to a pre-modern legal and ethnographic question. Halachic identity is determined by matrilineal descent, documented through records, not by haplogroups. Your demand is a confession of profound ignorance.
>>514380384Your map in the post I replied to disagrees with the plurality given this context.
>>514374325 https://www.youtube.com/watch?v=uqs9a2Cxv5cUkrainian drones struck multiple energy sites in Russia overnight, the General Staff reports. A refinery in Syzran, Samara region, was hit, causing a large fire, while another drone strike set ablaze a processing unit at a refinery in Krasnodar. Drones also targeted a chemical plant in Alexin, Tula region.https://x.com/NOELreports/status/1961690357269139600pic https://litter.catbox.moe/83mur3rqv8kfabql.jpgvideo 1https://litter.catbox.moe/u59vow4r6npl0ocz.mp4video 2https://litter.catbox.moe/vc73gsg6z6jwvq1v.mp4video 3https://litter.catbox.moe/ua7jjvwperk9q4j2.mp4
> AFU eliminated the main part of the Russians that broke into Novoselivka, - DeepState Yesterday, during the day, we managed to stabilize the defense in the village, although the enemy is still trying to enter the village through the beam.
>>514380609>Ukrainian drones struck multiple energy sites in Russia overnight, the General Staff reports. A refinery in Syzran, Samara region, was hit, causing a large fire, while another drone strike set ablaze a processing unit at a refinery in Krasnodar. Drones also targeted a chemical plant in Alexin, Tula region.video 1
>The EU is weighing legal ways to bypass unanimity in foreign policy, Bloomberg reports. A group of 12 countries backs shifting to qualified majority voting to speed up decisions on Ukraine and Russia, often blocked by Hungary.https://www.bloomberg.com/news/articles/2025-08-30/eu-explores-ways-of-acting-more-quickly-on-foreign-policy
>>514380445>matrilineal descent>secular standard (geneticsJew ai is transwomen a women?
>>514380609>Ukrainian drones struck multiple energy sites in Russia overnight, the General Staff reports. A refinery in Syzran, Samara region, was hit, causing a large fire, while another drone strike set ablaze a processing unit at a refinery in Krasnodar. Drones also targeted a chemical plant in Alexin, Tula region.video 2
>>514380368I was going to say that this is news from last week but it seems it's new aid, noice.also,>StarlinkBased. That feel when the US is being less difficult than Poland.
>>514380609>Ukrainian drones struck multiple energy sites in Russia overnight, the General Staff reports. A refinery in Syzran, Samara region, was hit, causing a large fire, while another drone strike set ablaze a processing unit at a refinery in Krasnodar. Drones also targeted a chemical plant in Alexin, Tula region.video 3
>>514380515Russian civilians did die at the highest number in WW2 out of all the republics. Of course this is not surprising, as Russians outnumbered Ukrainians (and citizens of other republics) in the Soviet union, even after the partition of Poland where a significant amount of Ukrainians came under soviet occupation.
> Russia’s general Gerasimov said "SVO" will continue. He claimed Russian forces control 99.7% of Luhansk, 79% of Donetsk, 74% of Zaporizhzhia, and 76% of Kherson regions.
>>514380691No, next question?
>>514380691
>>514380672Was getting the EU to federalize part of Orban's plan?
>>514380609 https://www.youtube.com/watch?v=pBGVfwOLU1wUkrainian drone strikes overnight caused a fire at an oil refinery in Krasnodar, Russia. Work by the 14th regiment of the Unmanned Systems Forces, in coordination with the Special Operations Forces.https://x.com/NOELreports/status/1961690918097981587video 1https://litter.catbox.moe/7bzsstie80aj56pv.mp4video 2https://litter.catbox.moe/4orn68dolazx0jgq.mp4video 3https://litter.catbox.moe/9ry9qiw9sszt4a7s.mp4
>>514380897>Ukrainian drone strikes overnight caused a fire at an oil refinery in Krasnodar, Russia. Work by the 14th regiment of the Unmanned Systems Forces, in coordination with the Special Operations Forces.video 1
>>514380786Why did he fail to mention the critical russian inroads into the Dnipropetrovsk and Sumy oblasts?
>>514380897>Ukrainian drone strikes overnight caused a fire at an oil refinery in Krasnodar, Russia. Work by the 14th regiment of the Unmanned Systems Forces, in coordination with the Special Operations Forces.video 2
>>514380897>Ukrainian drone strikes overnight caused a fire at an oil refinery in Krasnodar, Russia. Work by the 14th regiment of the Unmanned Systems Forces, in coordination with the Special Operations Forces.video 3
>>514380793Is a transjew a jew?
>>514380786wtf this faggot is still alive? mandela effect vibes right thereTZD tho
>>514380888Orban cigan want to get rid of veto? So that eu zog has even more power?
>>514381030I do not provide definitions for the words you invent.
>>514374481You sound like the standard nafo tranny. I'm sure some day you'll finally get over your desperate cope.
>>514380077>anon said that was a Konkurs the other dayI knew it was mines
>>514380672I wish this was real, but I heard it too many times to believe it.
>>514380897 https://www.youtube.com/watch?v=i-35cryNX8sThe Syzran oil refinery in Russia was also hit again by Ukrainian drones. The site, which has already faced multiple strikes in recent months, was set ablaze following the latest attack.https://x.com/NOELreports/status/1961691515282960809video 1https://litter.catbox.moe/9l5zoqk35yivvogw.mp4video 2https://litter.catbox.moe/9x2zv104w8lqxpwt.mp4
>>514381295>The Syzran oil refinery in Russia was also hit again by Ukrainian drones. The site, which has already faced multiple strikes in recent months, was set ablaze following the latest attack.video 1
>>514381072Orban was so obstinate that the EU started to figure out ways to bypass Hungary in making foreign policy decisions.Traditionally, the EU has always made external relations decisions unanimously. If the EU manages to find a way to bypass Orban, it will be a massive step towards majority voting in the area of external relations and, thus, federalisation (no national veto).
>>514381295>The Syzran oil refinery in Russia was also hit again by Ukrainian drones. The site, which has already faced multiple strikes in recent months, was set ablaze following the latest attack.video 2
>>514380631Lyman direction seems to me the most vulnerable to some kind of breakthrough. If they are smart they will divert forces from failed copensives at dobropillia and kupyanks there.
>>514380297Overnight Russian strikes hit Ukraine: in Zaporizhzhia 1 killed and 22 injured, including children, with 14 apartment blocks and 40+ houses damaged; in Dnipro and Pavlohrad infrastructure was hit and fires broke out; blasts also reported in Kyiv region, Ivano-Frankivsk, Khmelnytskyi, Chernihiv, Cherkasy and Volyn, with rail damage near Kyiv delaying trains.https://x.com/NOELreports/status/1961691831852269676
>>514381295As of this morning, the Syzran oil refinery is burning.https://x.com/NOELreports/status/1961692240624968009
Reports from Sevastopol in occupied Crimea suggest Ukrainian drones struck facilities storing aviation fuel. This is yet to be confirmed.https://x.com/NOELreports/status/1961692558360215644https://litter.catbox.moe/7euah6dcz20ts8d4.mp4
According to unconfirmed reports, Ukraine struck a Russian S-400 air defense system north of Armyansk-Perekop in occupied Crimea. The extent of the damage is still being verified.https://x.com/NOELreports/status/1961693040289951913
>>514380297Trajectory of Russian missiles and drones during the attack at night. The main focus of the attack was Lutsk, Rivne, Dubno, Kyiv, Dnipro, Zaporizhzia and Pavlohrad while front line positions near Pokrovsk were struck with Shahed drones.https://x.com/NOELreports/status/1961693794727809307
>>514380368US envoy to NATO Matthew Whitaker said Washington is providing Ukraine with “deeper strike capabilities” likely to be used inside Russian territory, referencing new ERAM missile sales and allied purchases. However, this is not an official White House statement or confirmation.https://x.com/NOELreports/status/1961694683995750740
>>514381287I'm doubtful it will work as intended anyway. It will solve the problem of one country holding up the rest of the union, but it could also force the union to be pushed in a direction its majority doesn't want unless voting in the Commission is weighted by population and/or wealth.If it passes you could have an EU where the 14 least populated countries whose sum is about ~50M could outvote the remaining 400M Europeans. That may be better than the current any old random shitter blocking the EU we have at present but it's not a change worth writing a brand new treaty and expending so much political and diplomatic capital for if you can consider that as a resource.The EU should change its voting mechanisms to allow weighted voting by population or even GDP. So Germany, France .etc have much more of a say and can't simply be outvoted by Cyprus or Malta or whoever decides to throw a tantrum.t. my country was the chief tantrum instigator in the union
German Chancellor Friedrich Merz stated that Russia is attempting to destabilize Germany, including targeting its infrastructure, and therefore Berlin is in direct conflict with Moscow.https://x.com/NOELreports/status/1961741525143949425
>>514381377>If they are smartChecked, but you expect to much from Ziggers anon
>>514380897Ukraine's SSO confirms they struck the Krasnodar oil refinery overnight. The facility produces around 3 million tons of light petroleum products annually, including fuel for the Russian military. Analysts note that if Ukraine maintains this strike tempo for a year, the loss of refining capacity could trigger a crisis in Russia.https://x.com/NOELreports/status/1961742056012812406
>Axios reports that Trump may temporarily halt Ukraine peace talks unless both sides show more flexibility, citing a senior U.S. official. Meanwhile, Russia’s Chief of General Staff Gerasimov said combat operations continue and Russian forces are pressing along the entire front.
>>514374481And you sound like a fucking retard who wastes his time 24/7 for nothing just like a faggot.
>>514381361Eu zog just changes the rules when orban cigan is annoying
An explosion was reported near the airport in occupied Simferopol, followed by rising smoke. It is not clear what caused the explosion.https://x.com/NOELreports/status/1961744394567979417https://litter.catbox.moe/7kkhu948hruhk1uc.mp4
>The Russian Volunteer Corps captured weapons from Russian troops after assault operations at the Donetsk front.
>>514381699Thats actually solved, it's called qualified majority.Article 16 also states the conditions for a qualified majority, effective since 1 November 2014:Majority of countries: 55% (comprising at least 15 of them) andMajority of population: 65%.
>>514381865You do the same, jewish tranny.
Aerial reconnaissance by Ukraine’s 1st Azov Corps documented another Russian war crime on August 28 in Donetsk region. Footage shows a soldier of Russia’s 95th Separate Rifle Regiment shooting an unarmed elderly civilian outside his home in Pokrovsk district. The victim was clearly in civilian clothing and unarmed.https://x.com/NOELreports/status/1961745144400560453https://litter.catbox.moe/3xdpar4n7xe2p1je.mp4>>514381917 32
>>514374480>Germany needs muh Russian gasNo lol. Gas prices have been lower and more stable than ever before fore the last two years. Turns out buying your gas from whoever you want instead of being dependent on a single fart pipe from a certain shithole is a pretty good thing, who would have known that.>Germany’s autos industry, one of the European country’s largest sectors, has seen job cuts of close to 7% of the workforce, or around 51,500 positionsHas nothing to do with gas, that's mostly because some retards in the industry sold key technologies to China instead of building them themselves.
>Russia is finalizing its strategic regrouping.>Having redeployed forces from Sumy and Kherson, its offensive will likely enter a new phase soon.What do we think of this?
>>514374481the shills sure got mad over getting called brown lmao.
Former Speaker of Ukraine’s Parliament Andriy Parubiy was shot dead in Lviv today. The attacker, disguised as a Glovo courier on an e-bike, fired 8 shots and fled. President Zelensky called it a “horrific murder” and vowed a full investigation as security services hunt the suspect.https://x.com/NOELreports/status/1961745790566638017https://litter.catbox.moe/edzw66y2i4neksj4.mp4
>>514377454There s no big genetic differnce between ukroturks and russhits savages. Both are the same subhuman people hitler wanted resettled.But since most retards inhabiting pol today are newfags from reddit or whatever shithole they came from and are educated on the ukraine crisis only after 2022 forgot this stuff.
>>514381228>nafo trannyLMAO, you're talking to someone who bullies trannies constantly
>>514382101yeah, truth hurts
EU foreign policy chief Kaja Kallas said Russia will not get back its frozen assets in Europe unless it pays reparations to Ukraine. Politico earlier reported the EU is preparing to finalize plans to transfer about €200B into a fund for Ukraine’s reconstruction.https://x.com/NOELreports/status/1961746201457369315https://litter.catbox.moe/25p304gss2fj2jfh.mp4
>>514382101Yeah they even cry about that on their discord on a regular basis lmao.
>>514382137>ukrainians get an ss unit>russians get a bullet
>>514381847>>514381944Only in the Council. Not the Commission which is where Orban, or anyone who cares to, outvotes the bloc. And the Commission is the executive body.Tbh the EU should have been modelled after the British method which gives parliament supreme authority over everything and there shouldn't even have been a council or commission because any such structure would operate within parliament. But that may have been moving too fast for people's liking.
A Mirage 2000-5F fighter jet in Ukrainian livery, flying over Ukraine. Additional French Mirage-2000 aircraft are expected to be transferred to the Ukrainian Air Force.https://x.com/NOELreports/status/1961747166067576874
>>514382201Someone, give this bitch e-scooter with a bomb). Her husband receives money from russia.
>>514381759Politico reports that German company Quantum Systems has launched secret factories in Ukraine producing Vector reconnaissance drones with AI. Around 80 units are manufactured each month.https://x.com/NOELreports/status/1961752149764808906
>>514382226Educate yourself more on what hitler spoke at the table talks. There s a whole archive. Go look out. "As for the ridiculous amount of slavs...."This is also available for any other retard contradicting this. Have fun.
>>514374325 https://www.youtube.com/watch?v=l80_R2HvXIUA Ukrainian MiG-29 struck a Russian troop concentration in the north using French-supplied AASM Hammer guided bombs, inflicting heavy losses.https://x.com/NOELreports/status/1961757149291229201https://litter.catbox.moe/idtk666n57vgzw2j.mp4
>>514382253>Ukrainian liveryIt looks kino.
>>514374325Ukraine’s military intelligence struck an underground explosives depot at the Aleksin Chemical Plant in Russia’s Tula region overnight, RBC-Ukraine reports. The site stored pyroxylin powder used in ammunition and rocket engines. Loud explosions were heard, and ambulances were dispatched to the scene.https://x.com/NOELreports/status/1961762560048267602pic 1https://litter.catbox.moe/0r485u0dl0sz493d.jpgpic 2https://litter.catbox.moe/ah9igcpyp48etaff.png
>>514382441Ukroturks arent nazis they re the perfect subhuman slaves. Always been like that. Same for the russhits.No wonder why you fags hate each other. Poleshits included.
>>514374782Not the horses bros... Hitler got ptsd when serving WW1 about horses choking to death on mustard gas and it's one of the main reason why they didn't use chem warfare for WW2 electric boogaloo.
>>514382441>>514381865Drop the memeflag Ranjeet, we know this is you.And no, your people ar not Aryan..
>>514374325 https://www.youtube.com/watch?v=l80_R2HvXIU Ukrainian MiG-29MU1 carried out a precision strike with two AASM Hammer guided bombs, eliminating a Russian troop group.https://x.com/NOELreports/status/1961769929671164059https://litter.catbox.moe/yuoz1q2qbrsnai48.mp4
>>514382227Ok, sorry, but you seem to be miying things up. Orbán is in the council, where some decisions, like foreign policy, currently require unanimity. Some items require qualified (double) majority. This is what they are trying to change now, so that the council can make foreign policy decisions based on qualified majority. The Commission is not made out of country government heads, but are elected by the European Parliament from member state candidates. Orbán has no word in the Commission, besides one commissioner responsible for a specific area, and has no veto power there, but he has veto power in many agenda items in the Council, including foreign policy.
>>514382314Any drone knowers?Is AI targetting for drones real or just hype invented by contractors for government grants? I read recently that zegroids have also claimed to make some AI-targetting system for their drones.
>>514382441>>514382541>replying to himselfGlavset isn’t sending their best.
>>514382690Still using aircraft older than gen 4? Sad
>>514382596I remember a D-Day veteran, thinking back that the strongest memories he has of Normandy were the stench of the 1000s of dead horses just lying around, sometimes exploding because of gas buildup.
>>514382441next youre going to say the holocaust happened.
>>514374325 RUN NIGGER!In the past two weeks, SBU’s “Alpha” units reported destroying 20 tanks, 41 armored vehicles, 94 artillery and MLRS systems, 16 air defense systems, 8 EW assets, 764 vehicles, 107 drones, 317 antennas, 983 enemy positions, 32 ammo depots and 7 fuel depots—eliminating over 1,000 Russian troops.https://x.com/NOELreports/status/1961773051005079570https://litter.catbox.moe/95c9hzqasjryi89k.mp4
>>514382793its real but not at the operational level yet.
>>514382793Afaik the drones used in operation spiderweb used AI-targeting, so yeah it's a real thing and not just some techbro fantasy.
>>514382846>Russia can’t shoot these down
>In Yablonovsky, Adygea, so-called “debris” from a downed Ukrainian drone damaged homes, a workshop, and two offices. One person was injured. Once again, Russian air defense turns drones into falling wreckage that causes the very destruction it claims to prevent.
>Russia aims to seize Pokrovsk, push toward Sloviansk-Kramatorsk, and even into Dnipropetrovsk region—a political goal, says Dnipro Grouping Spokesperson Viktor Tregubov. He noted Russian groups near Dobropillia are cut off from supplies and their elimination is only a matter of time.
> Rosneft’s net profit fell by more than 68% in the first half of the year due to low oil prices, - the company’s director said.
>>514383019That's actually pretty funny, russians were using the same logic. Let's be honest, drone debris falling on a residential home, injuring one person is preferable to it destroying an aircraft for example. Unfortunate calculus of war.
Axios reports that Trump may temporarily halt Ukraine peace talks unless both sides show more flexibility, citing a senior U.S. official. Meanwhile, Russia’s Chief of General Staff Gerasimov said combat operations continue and Russian forces are pressing along the entire front.https://x.com/NOELreports/status/1961782140024074254
what usa doing?
>Trump has cancelled future plans to visit India, and his relationship with Modi "is officially on the outs. According to US officials familiar with Trump's schedule - NYT
>>514383223America will regret messing with a global south superpower.
The Russian Volunteer Corps captured weapons from Russian troops after assault operations at the Donetsk front.https://x.com/NOELreports/status/1961786363889475988
>>514382253thank you based JVPITER
>>514382793It is definitely doable putting image recognition based on machine learning in a package small enough to fit on a drone. Whether anyone has made it good enough for production use yet, I don't know.
https://xcancel.com/Q0MT6pFmbVqynsM/status/1961778566883873186#m>Rostov.Oxyland Park in Merzhanovo burned down along with the lighthouse. Now the fire has spread to houses in the village (t.me/etorostov/99519)
>>514382253>70s-era techlol
Another tranny goes on to live away from the evil transphobic west
>>514374325In Yablonovsky, Adygea, so-called “debris” from a downed Ukrainian drone damaged homes, a workshop, and two offices. One person was injured. Once again, Russian air defense turns drones into falling wreckage that causes the very destruction it claims to prevent.https://x.com/NOELreports/status/1961791386560106937video 1https://litter.catbox.moe/i3zlvihiriiv9cph.mp4video 2https://litter.catbox.moe/k3sfwyczp76u1930.mp4pichttps://litter.catbox.moe/jcc0z1tytgb1ug1s.jpg
>>514383223I have also cancelled all my future plans to India
>>514383707damn she has a nice moustache
>>514383768>In Yablonovsky, Adygea, so-called “debris” from a downed Ukrainian drone damaged homes, a workshop, and two offices. One person was injured. Once again, Russian air defense turns drones into falling wreckage that causes the very destruction it claims to prevent.video 1
>>514383768>In Yablonovsky, Adygea, so-called “debris” from a downed Ukrainian drone damaged homes, a workshop, and two offices. One person was injured. Once again, Russian air defense turns drones into falling wreckage that causes the very destruction it claims to prevent.video 2
Russia’s plans on the Pokrovsk front include capturing the city, pushing north toward the Sloviansk-Kramatorsk area, and even advancing into Dnipropetrovsk region—a goal Ukraine’s military calls purely political, said Strategic Grouping Dnipro spokesman Viktor Tregubov. He added that Russian groups remain in tree lines near Dobropillia but are cut off from supplies, making their presence only a matter of time.https://x.com/NOELreports/status/1961792280894886229
>>514375233The CIA>>514374907>14:1Stalin killed way more of you. And you're still mad.
>>514383938stalin loved black men
>>514383938Stalin also killed way more rusniggers. Rusniggers are known for worshipping people that kill the most of them. They are bigger cucks than chinks.
>>514383938>And you're still mad.it wasn't that long ago
baking
>>514382956That's just ardupilot
>>514383453Pidors are using 50's era tech like BRDMs lol>lmao even
>>514383707Why are they all trooning out?
>>514384657russia and mental illness go hand in hand
Is he ok ?
>>514384657They always were troons. Troons are usually mentally ill commies and mentally ill commies support rusnigeria.
>>514382956https://youtu.be/O0CkmTN1q5A?si=nnx3nkrYcdTNwURnThis is probably what was used
>>514374325Was he ok?
>>514384748no matter how hard you try, it wont work. the association between ukraine supporters and trannies is just as strong as the association between stink and shit.
>>514384893>>514384893>>514384893
>>514384878>he got so mad that he stopped his split bakingKEKAROOO!
>>514384748Troonism is a product of capitalism and Ukraine is a capitalist country.
>>514384647>no more BMPs>no more BTRs Grim.
>>514384878Being mad at truth is a tranny commie behavior. It also leads to severe depression. I suggest you just accept what you are.
