From the twisted mind of Jun Maeda who brought you Angel Beats!, Clannad, AIR, Little Busters!, Summer Pockets and Charlotte.>Is it on PC?Yes, it's on PC and mobile.>Trailershttps://www.youtube.com/watch?v=qA1mOkiaukg https://www.youtube.com/watch?v=GWtm4uZrDM0 >Twitterhttps://x.com/hbr_official_en>Database/Tier listhttp://hbr.quest/https://docs.google.com/spreadsheets/d/e/2PACX-1vRE8-R_xoNaUGGUMa_tHbq4NgUVcO9DzPQ5g9jhPBdOTdTjxsdW5yT3JteKfoS2xxzoyqItREEXSycW/pubhtmlRoll the guaranteed SS banner!>Downloadhttps://heavenburnsred.yo-star.com/>Current event3000 bonus quartz>How to deal with malicious spoilersEveryone make up your own spoilers to dilute ittags: yuri, JRPG, comedyPrevious:>>503335635
Stinky.
I feel like I spent ridiculous amount of time on this gacha already and I'm still not done with everything story related.
>>503395641You should use my friend's code. uaul9268mefczyim
I love Maria
>>503395641You should use my code or else testicular torsion 7066wr6b7zheg93q
>>503395509All events are worth doing. U140 and Carole get referenced in 532 different places in the game, so you don't want to miss out on them. 31E events are like a mini story line, you're supposed to play them all if you care about the unit. Misato event is the only one that's kinda skipable.
Oh got one poor soul to use my code and that's enough for me.
Newcuties, please use the following code : kuejbiqmmcenznuv to get 1000 jimmies
Can't wait for the event that turns these two into one of the cutest ships in the game.
gacha junkies already out of rolls again I see
>>503396526I'm out of things to roll for.
Pinkbros, use my code: 6abepm5tgwjemdxj
do i gain anything from doing patrols constantly? I enter and just see 100%
Finished c1.Should i grind and clean the first event store with my LP? I can only do the 7500 one.
>three girls whose whole gimmick is depressionwhy is maeda like this
fucking homosexuals
>>503396773Gaslighting works.
Remember to molest Nanamin
>>503396765>why is maeda like thisHe can't help himself
>>503396746No, I would keep some LP for later. You can grind for rolls and quartz though.
>>503396746Is is still 3x token? You will level very fast with flashback event boss fight
>Mari's dad was a bad dad for forcing tradition on her>Inori's dad was a bad dad for forcing tradition on herAre all the tragic backstories gonna be the same?
This is literally a blowjob gesture... Why does nanami do this every time we finish training
1 month for new chapter bwos
>m.jpg>(1) evenI respect fellow Nanamin posters but...
>>503397069Fuck off maeda you ain't taro 1 is enough
Bid sadness
>>503397235Yes it is.
>>503396693Did you kill the boss? You need to kill the boss to complete it
>>503397319The last time Maeda wasn't utterly shit at writing anything to do with parents was in Clannad 20 years ago. In general he's got this weird problem where what he wants to write isn't quite the same as what he's good at writing.
>>503397352Ruka is canonically futanari
Do I get harem if I max personality
>>503396693JPbro here. You need to patrol on certain nights or a big cancer will attack and wipe out the base and bad end you.Not really a JPbro. I made that shit up.
>>503397935>Big sadnesshttps://www.youtube.com/watch?v=RZViU741Psw
>>503397319If anything, Inori's event was romanticizing executioners and beheadings. Which isn't anything new for japanese, but does look weird from the viewpoint of other cultures.
>>503397352I think she's just, you know, fixing her hair. I know you only see that kind of thing in sex because you don't see woman in your life and all, but still.
>>503398092Most of the events aren't actually written by Maeda, but by the other key writers. I don't remember about Mari, but Inori is not his event.
It's funny to me that the most stressful gameplay thing we have is trying to execute everything as fast as possible while you're setting up the hyperbolic time chamber in order to get the most efficient clear times.
>>503397319Actual media literacy problems
>>503397319Mari's dad wasn't bad, it's just her mom was a passive fuck and was hoping she'd act like a bitch before helping her in any way or form.
>>503399002I thought it doesn't follow your first clear time?
Inorin ruining my canon team...
Guys, I'm playing in a salted account but I just realised that I can't download the game in my tablet becuase it's not available in my region. Is it risky not bind it? should I find a workaroun to download the game on mobile and bind it?
>>503399353From what I heard, it does. It just adds 20 or so seconds to whatever the clear time was.
>>503399437why do you hate Ruka?
>>503399478Good to know actually. Wish a jpbro could confirm it.
>>503399498I just put an attacker in for another, bwo...
Anyone here make any progress with clock tower? I'm up to floor 3, but it completely rapes me. I'm waiting until I get a little bit more gear before I try again.
>>503400220i'm hardwalled by the 2nd floor all i have are slash units besides ichigo who i haven't even levelled yet...
Why does the alchemist's voice sound so familiar?
>>503400587Dunno. She apparently has very little roles in the industry. But I like the voice.
This is a trap right?
>>503400903Isn't this her exclusive gear?
>>503400831HBR has a lot of really good VAs with not much experience.
>>503400903It's -150,000 GP, but if you're gonna be using her for a while, I don't think it's terrible.
>>503400903Buy if you use her.
Holy fuck Ch2 was cringe and stupid. The event story after made it even worse.
>>503398868That's looking at it narrowly, it's a more general sentiment about minimising suffering when killing in any situation where killing is necessary, be it in execution of criminals, combat against an enemy, or even hunting / animal husbandry.
>>503401236fuck u aoi hater
>>503400903Traps are exp book and level primer. You can actually gain exp faster in flashback fight
>>503401236This but chapter 3. Thought I'd like it more than I did a couple of years ago in the JP version, but no, it's still a mediocre chapter with a bad focus character and too many dungeons.
>>503401261I wish Inori would minimize my suffering, bros...
Would you a Narby?
>>503401669They do look tasty
so it's a harem speedrun for Ruka and insult competition for the rest?
>>503401669I really shouldn't stick my penis in that...........BUT,
>an actual dungeon layout even if it's just left and right in a gacha gamen-nan... dato...?!
I finally unlocked garden of reflection.I am free! Used up all of my energy points, finally
damn the gioppenese
>>503402217karin said it the best. You are gonna explore all of them anyways
>>503402217Soon you will wish you it was never a thing. But apparently 3D is better. Me personally? Don't care used to play Tales of the Ray global -> JP and they had the same kind of dungeons as they do in the tales vita games. Dumbed down but effective dungeons.
>>503401236poka
sugayan makes for some funny reactions
>>503399586Can confirm, in addition to the 20s there's also a minimum clear time. For the time chamber the minimum c;ear time is 1:00, so the fastest time you can get is 1:20.I cleared this one on turn 1 so it was probably like 12 seconds.
>>503402836>41 hours of auto dailyhmm nyes
>>503402836Ruka is slacking off on her own
>>503402836what is the typical quartz income for the game? passes look nice since after 3 months they just crap out SS tokens
>>503403719if you are asking gems, 300 rolls a year.but the game have a lot of events where you get extra roll tickets or free rolls every day for X days
>ch3 double mountain recon dayMAEEEEEEEEDAAAAAAAAAAAA
I am so tempted to do the $20 crush ticket for a chance at Aoi since the Megumin on that ticket is T1
>>503403719It's honestly hard to tell because there are a lot of free quartz events and free rolls. I don't really track it.If you are going to pay, the pass is worth it. It's better value than what you can otherwise get.
>>503404105akshually she is the weakest meg. aoi is the best and monaka is still a strong dark aoe dps to this day on jaypee
>>503404283She comes with the aoe weakness break though, so you can't actually play meg without her.
I just got Tsukasa's SS1 and Sumomo's SS1, how useful are they?
>>503404283ah yeah meant monaka im still learning the names
>>503404537SS1 Tsukasa is good for fire
>>503404283megumin deserves to be a 10 somewhere
>>503404483I can play with meg
>killed chapter 2 medusa like 8 times (literally overkilling) without giving her a single turn of activity thanks to all those overdrive and boon extra turns>still fleesMY IMMERSION
i want to fuck yuki
>>503404780gameplay is not canon
>>503404747She's already a 10 in personality, looks and psychic power. If she was also 10 meta-wise it would be too much.
My final 5-step 10 roll, did I get anything good?
>>503404896Marumaru W
>>503403921>300 rolls a year.That's 2 pities, yeah? A year? Yikes.
>>503404896Give me the boyish loli please.
>>503404896Marumaru has been doing a lot for me
>>503403719Half a year for a spark. 5 to 6 "roll or die" banners a year besides limited/collab banners. Global will likely get double the banner number since the speedup is already in full power.
>>503404896Marumaru is very cute and you should spoil her.
>>503404712I have that fire Ruka so that's good at least.
i want ichigo and sumomo to die
>>503405338Wtf meow
>>503404968>2 pitiesThat JPbro wishes ...
>>503405338>sumomoBut I just got her and somehow I have her sister at LB1.
>>503405038oh I really wanted to ask about the Limit breaks. SS needs 20 tokens for lvl 3 right?
Am I doing this right
>>503405038I'm just going to roll on every single meta unit banner with every single gem that I have at the time and hope that fortunate smiles upon my weary soul.
>>503404747Her miko style is high tier for fire teams.
>>503405881PIIIIIIIIIIIIIIIIIIIIITS UGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGAUGA
>>503405784Don't do that bro, spark gachas are cruelt. just rolled 200 times in a different gacha and got 5 SSRs but not the banner one, had to spark to get a single copy, that felt even worse than being an absolute lucklet
>>503405881megumin's honkers...
>>503405460Well, it is 2 pities for en.>>50340556310->20->40->60>>503405784Being very lucky is the only real way to play without whaling, if you fall behind you won't really recover as f2p without getting even more lucky and getting whatever you missed as offrate, if it's not limited. There's a reason why every tierlist is based on owning every single SS style in the game.
>>503404483I got her a while back and forgot all about her. Definitely going to remember from now on.
>>503405591This is not MSFR, you don't have to buy it like a stock and hold it
>>503406385jpbros when it says 1x int 2x luck what is the actual maths here for the % effectiveness?
>>503406379At least we can see what's coming up and focus on getting units that are good for a long time like Yunyun and Sharo.
>>503406278>spark gachas are cruel"""Spark""" gachas usually let you pity more than 2 units per year, and the new wave of gachas only release like 8 characters per year. This game is 2 pities per year, with like I don't even fucking know, 24 characters? It's not sustainable unless you roll the dice.
is that what they call "foreshadowing"?
>>503406821I don't think saying that dangerous fights are dangerous counts as foreshadowing
>>503404896>4 of the 6 sisters in the same rollImagine if you were to get the 6 at the same time
>>503406515that's enough for 5 characters on the 4 slot boosters so he's actually sort of doing it right if he puts offensive stuff on his attacker. i'm doing a 4-2 split on my all A rank 31-A run in chapter 3, but i might put offensive chips on karen instead since she's a backline sitter most of the time anyway
join the church
I finally got S Yingxia but I already have Shiki at LB3, is there any reason to switch to her now?
>>503405338Gun sisters are cute. Retarded but cute
>>503407323i'd do anything for you, nanamin
>>503407323I'm joining the church of boys (girl)
>>503407323nanawife
>>503406379wtf you need 14 copies for max LB?
>>503407323Why did they make her so sexual? And you can't even whale for her, what were they thinking
>>503407527pay up piggy
>>503407323I was born in that church
>>503407503the red panda backpack is pretty cute also nice boy
>>503407503that's a really cute backpack, i want it
>>503407258I always think there will be better stuff coming in the future so I don't buy the current stock of chipsGuess I should invest in it
>>503407527You never really roll for copies to lb, unless you're a leviathan or accidentally get double. You lb with shards or weekly charge stuff thingie. Global will have an easier time since it seems like every event will have 3 SS shards.Also lbs past lb1 matter little outside of very few styles with good lb3 passives.
>>503407527he's trolling you it's 10/10/20/20see my yamazaki's at mlb1 and to get to mlb2 is only 10 shards.
Finished chapter 3 and I'm not convinced. It's a lot of reading and running around for so little story progression. Gonna go try JJK.
Why would a teenage girl in the military know this
>>503406569There's a formula where your stat is compared against the enemy's stat. If your stat+your skill parameter cap is equal or greater than the enemy stat, you have full damage or effectiveness. If your stat is too low, you get minimum effectiveness. In the range from (enemy stat - skill parameter cap) to (enemy stat), your effectiveness is scaled from the minimum value to the maximum value.Also, your stat is often calculated using multiple stats, such as the average of 2x str and 1x dex. So (2xstr+1xdex)/3 = stat.
>>503408140She played Persona 5.
>>503407387YunYun has defense down in addition to enhance, whereas Shiki has charge. There is a reason, but whether it makes sense depends on your team (and ability to level her fast).
>>503408140i responded all of the asami's question correctly because i found it funny for ruka to do that
Hiroshima is the Detroit of Japan or something? Why does Maki talk like a nigger in the subs
Tama status?
>>503408737OI'd
>>503408737MIMI GAAAAAAAAAAAAAAAA
>>503408140>tenage girlFROM JAPAN
>>503408737Slain by a cat.
>>503408737
yunyun kinda sucks as a story character, i hate they force you to use her cause of how strong she is.
>>503408737annoying but a cute team mascot
>>503408140She's a JRPG character. What if she suddenly needed to fetch Kopi Luwak for an important side quest?
>>503407323>>503407632shes not rollable? what a waste
This is where your money is going btw.
>>503408978Honestly the squads outside of 31-A, 31-B, 31-C, and 30-G feel very superfluous. Like they were added because they needed to pad the gacha.
>>503409418They probably paid him 5 bucks.
>>503408737Otama'd
>>503409454It's not "like". This is actually confirmed. Thankfully they got a fair amount of love and care in the JP version so now it doesn't feel nearly as bad.
So, what's the optimal way to paypig in this game? I suppose its the monthly passes, but aside those
>>503409418>your moneythat's exactly why it's not *my* money
>>503409758Aside from monthly passes, you always want to buy quartz packs with extras. This could be 10 SS pieces, 50% more quartz, or 2 10 roll tickets on a banner. Never buy blank 10k quartz unless you really want to set your money on fire.
>>503409758Get the guaranteed SS packs.
>>503409418That's probably the anon that keeps sucking Maeda's dick
>>503409758there isn't one, seriously, it's one of the worst money-worth cases that I've seen in mobage
>>503409418you can go back to your shithole now, Chinkoid>>>/vg/gig>>>/vg/hsrg>>>/vg/wuwa
>>503410194>$20 for a 10 rollIt's so bad.
>misato can actually get misarin nicknameYeah the translation team for the main story and the rest of the game are different. That's wack I hate this inconsistency
Do you know... the secret of the world?
I want to fuck her.
>>503410194>seriously, it's one of the worst money-worth cases that I've seen in mobage??? u played 1 mobage your whole life? these packs are middle of the pack. there's a lot worse bro. dokkanshart dragon ball legends shart
>>503410194bro didn't play the love live gacha. it was like 30 dollars for a 10, probably more, but it's been a very long time. JP gachas are very expensive as a rule. 20 for a 10 pull isn't that bad for a JP gacha
>>503410610would you her eye socket?
>>503410610I don't
Use my code!t5qgy5gqnab5z3ka
>>503411183my sexy forehead wife...
>Can't buy anything on my phone and get google play points because Yostar didn't release it in my region
>>503407503She actually looks like a girl here, shame about her normal portrait.
>Finished chapter 3How are they reacting about the narby thing in chapter 4 futurebwos?
>>503412315Trust me, the less you know, the better. 4.1 is easily one of the best chapters in the game.
>Yuina is just SeibaWill the Fate wank ever end for the gacha industry?
>>503413015>hurr fate invented woman with sword
I like how you can guess pretty much all of them just by looking at their legs
>Yuina is just Yuki but actually fun and not annoying what's the point of having someone like Yuki...
>>503413085She literally does the excaliber shit in her Saintly Smile attack.
>>503413015Sabuh's kit but she looks more like the sword princess from danmachi
>>503413125the lower the stockings the more of a slut they are. tsukasa is the most seiso
>>503413125LOVE the runs in Tojo's pantyhose. I'm blessed with her LB1 her memento mori does like 48k all day
>>503413236so Karen is a whore?
>>503413236No, it's the higher the grade of ZR they have, the sluttier they are.
>>503413136yuina's event was amazing, i love her.
>>503413320Nah, Tama is actually the sluttiest in that picture, but it requires experience to notice
>>503413320you just realized? she has a buttplug
>>503413552you don't? i thought it's normal
>>503413320yeah, Karen-chan is the purest though
>>503413205>fate invented sword blastsplease tell us what else fate inventedoh yeah, fate also invented jeanne d'arc, the character she's more alike to, and european history, right.
BLOND GIRL? SEIBAH? IN MY GOTCHA? I'M GONNA BAAAAAAAAAAAAAAAAAAAAAAAAT
Doesn't that mean Adel is also saber?
>>503414094No, because Adel is a NINJA.
>>503414094Adel is Mirin from GBF
Shion sexoMirin sexo
>finish chapter 1 and do the step recruit>these are my SSam i bricked bigly?what should my team be?
>Yuki gets gaslighted into loving Ruka>Yuina gets gaslighted into thinking Ruka is in love with her>Both have Unison featuring herYurisisters?
>>503414570fuck you bitch
Why do the devs hate Fubuki and Shiki?
>>503414849Fubuki is just punk rock RukaShiki is too much of a chad for everyone to handle
>>503414570you have more than me. that's just bragging at this point.
>>503414570>no AoiYou losted, biggerly
>>503414570I hope your waifus get raped by me
How much fucking hp does this thing have
>>503415494You're fighting the nerfed version so not a lot but you need to learn to have a blaster to increase the damage you do to it.
>>503415605Misato sucks!
>>503415494you see that 146/999% that's the devastation rate you slowly ramp up damage towards it. its really beefy but it has much higher rate then any other bosses that're usually around the 300%-400 range.
Tama is a whore
>>503415740Megumi's whore!
sisters she's so cute...
>>503415670Jk she pumped 146k after. I like her. And she's getting buffed in the clock tower too
I'm confused about boosters and accessories. If I have the same character on four teams, I have to buy four boosters + n*4 slots worth of chips?
>>503415740
>>503415801canon wife
>>503416343more like the mistress who is infinitely better than the legal wife
>>503415801
What item's can I ignore in the event shops?
>>503415801Yuki could never
events that doesn't have x3 FUCKING SUCKS
>>503415605Is it better to have 2 blaster and one attacker to take advantage of it?
>>503416447Yukkie is best
Can I start doing events at the end of chapter 1?
>>503416128No, you just need 6 total for your entire squad. Different squads can share accessories and boosters at the same time.
wish me luck
>>503417494hope you get kura like I did
>>503417494
>>503417258Some are locked behind chapter 2, including the current one
>>503417494who you want tho
>>503416656I hope yuina gets lewded more
>>503417494DE GOZARU
>>503417564>>503417570>>503417937>>503417943>>503418040It's over...
OI TAMA
So uuuh... My party is maxed out...
>>503418215that's a handsome lady
>>503418215that bitch is so fucking ugly
Unfaithful slut
>>503418215That ass looks decent
proofreading doko?
>>503418564What? Seems fine to me. I did notice an instance of "to to" in a sentence though.
>>503418741>pyscho
>>503418215She is very intimidating.
>>503418971Fug my brain auto corrected it. You have a keen eye.
>>503418564karrie is not the smartest
>>503418215Ugliest girl
I don't think she said that.
>>503418421Yukkie would do this to her
I'M INwhere do I roll on other than the daily free banner?I picked Tama for my tutorial btw
>casually drop $200 like a moronA-At least I got them all...
>>503420173the setup banner you get 2 ss garanteed for 40 rolls.
>>503420175thanks you for keeping the server alive
>>503420175
>>503420298You sure? I mean, the beginner and release celebration banners expire earlier, just wanted to confirn
Where are you getting all the money to whale? I thought we were all NEETs here?
>>503420573those banners have no guarantee ss.ur basically just throwing rolls into a bait banner you'd be better off just rolling the step up banner 40 times then just hoarding rolls for whenever a rateup has a unit you want on it.
>>503420671old news bro, the neet/f2p era of /vg/ is over, now everyone is dropping 500 bucks monthly on at least one gacha and calls you a poorfag seanigger if you don't
do I have to make a new email each time I want to reroll? I'm not sure if I'm just retarded and missing something
>>503420865yes at least on pc, it might be different if you rerolled on mobile but idk cause i haven't checked it there.
>>503420865salt your email
>>503420865kind of, but you can just salt the email. put a dot literally anywhere and the game will treat it as a different address even though every single message will go to the same inbox. it's pretty convenient tbdesu.or just put +1, +2, +3 etc. at the end. same result.
>>503420671he sells feetpics on onlyfans using a voice changer.
How long do skills like enhancement and full enhance last?
>>503421163until you use a skill
>>503421163till they're used on ur next attack skill.
>>503421197>>503421245That's kind of lame. Why don't they last a few turns?
>>503421059I'll do that, ty
>>503421392cause how would u stack them if that was the case.
>>503421392If you press Overdrive while executing an action, it'll extend your turn and you'll be able to do stuff like double buff, double debuff, and attack again with your attacker.
stack two skill buffs and burst stack two skill buffs and burst thats how you play the game
>>503420175Thank you for december server fund
I'm gonna be honest, the strategy meetings where they constantly namedrop a bunch of Japanese places are painfully boring. I couldn't care less, but I bet the nips enjoy it.
>>503420175>tfw spent on this banner and still missed on Bon Ivar and Ruka>had to pity SeikaAt least my fellow piggy is doing well...
nhtaffx6ni9d5bkeIf you're a new player you can use my invite code and we'll both get gems.
>>503422192no wonder her potions suck, she can barely see anything with those bangs.
>>503418215I want her to KEK me.
I'm a baka JPsenpai who's never managed to clear 120+35 until today so feel free to give me praise~
>>503422281One-eyed cyclopes own this game.
よくやったパイセン
>>503422497i have no clue what that means i'm assuming score attacking but have a capoo
>>503422225i only use your code if we can do lewd dms first
>>503422746Yeah current score attack for us.
>Carole and Maria are racistbros what the fuck?
Can you rebind your account after rerolling? I can't be assed to remember which reroll number I'm at for each game, I'd rather bind it to my default email, anyone tried that yet?
>>503423025always write down your salt mails
bwos...
>>503423025You can rebind on mobile, so you'll have to download apk on emu
>>503423117ah yes, the moment when I realized that being a professional retard may not be as in-character for Ruka as I thought it would
>>503423025Well start being assed to lol
Are narbies capable of giving consent?
>gold skitter(?) runs awayDid I just got bricked, bros?
You guys can't have bind codes like FGO because you just can't okay. Use Yostar account or your google email, instead of making rerolling easy like the other servers with bind codes which are just one and done combined with a password.
>literally says "texture" but the trannylators use reddit buzzword garbageI want to puke.
it's over...
>>503423304Oh that's great, how does that work, have you tried it?I started with my default email and rolled shit, now I'm wondering if I can rebind a reroll to the default email
>no boys exist so these cute girls can't get dickfucking yurigames....
>>503423774>he doesn't know
>>503423542>literally says redcrimson but it has to be vertex crimson>literally says crazy but it has to be eccentricity>literally says teheperinko but has to say whoopsie gravyMany such cases. Sad!>>503423524Bring Koju (Skill seal) or someone with Paralyze and it won't use the escape attack. Then you need to multi hit it.
>>503423774We are the boys.But these aren't girls, anon. They're slimes in human form.
>>503423864You forgot Rotary Mole into ATM.
>>503423525>bringing fugo out of all gamesEveryone hated the fact that you can't use multiple devices, now you can bind to an email and it was one of the best things happening to the game in past 8 years>>503423660The "user" button in settings have different menu on mobile, i changed my salted to normal version without issuesI don't know if you can rebind over existing account like in your case, but you could probably do extra actions and bind your original wasted reroll to a salted/different email then rebind your rerolled account back to normal
>>503423949HBR JP and FGO literally use the same bind code system the only difference is that HBR is one and done while FGO you have to keep rebinding after each use. Yostar just wanted to make rerolling difficult for no reason.
>>503423864>>literally says teheperinko but has to say whoopsie gravyI can defend this one. It's supposed to be English and tehepero > oopsie daisy is a close equivalent. There are bigger sins than a good localization for once.
>>503423898>It has an exact perfect copy of your DNA and houses your soul and is the only instance of you in the world currently but i-i-it doesn't count as youWhat's so special about your body being made of meat and calcium? If 90% of you is replaced by cybernetics, are you suddenly no longer human? That's not how it works.>>503423945I'm not playing EN, I just watch my friends play it on stream since they used to watch me stream JP and I live translated for them.
>>503424102>for no reason.the reason is very simplemost people don't know about salting and there's potential money to be made on them
>>503424195>teheperoBut it's literally teheperinko (to avoid copyright problems, presumably)
This wasn't hot it was just cringe ew wtf.
which students are squirters?
>>503424102I actually like this better than bind codes. Bind codes scare the shit out of me.
>>503424391H-hot.
>>503409168you can play as her biker version
>>503423774men exist in this universe, it's just gender separation.there's also one of the upcoming events...
>>503424102I don't even remember HBR system since i just used steam accountYostard does this to all games though, guest accounts take less clicks but salted emails aren't that much of an effort - they're probably doing it against botting for whatever marketing reasonsHoyoslop games are the same except they also make tutorial infinity long
>>503424391She's just looking out for you sis. You're an underclassman and she's your senior, so you have the wrong attitude here. It's same as finding a wet chair in your house when you have a toddler so you check with your finger to see if they peed themself.
>>503424540Misarin's event was about her male relative who played Go with her and finding him.
>>503424391This was actually really hot
So... The suffering begins now?
>>503424798There is no suffering in this family friendly game
>>503424798Hope you like hiking and skydiving without a parachute!
>>503424798dafuq is extirpate
Chapter 4 when...
How does the tail stay on and move by itself
>>503420671I'd imagine people who grew up with Key stuff mostly would have their wages one way or the other now.
>>503425025Tama dies. The end.
>>503424389no, anon, tehepero is just a slang term/expression, you can't really copyright that, it's like saying that you can copyright saying "neat". turning it into teheperinko is just supposed to make it sound cuter or dumber or even both. so oopsie daisy/whoopsie gravy are close i'd say.
>>503425025But Chapter 4 is already out sis, just click on it...>>503425118>tfw I share a birthday with a Clannad character
Having played the other WFS game I've grown to really enjoy their approach to fanservice. It's indoubtably there, but it's more stylistic than overtly direct. It's never going to be the usual KR/CN slop of huge milf tits jiggling in your face type of fanservice. They'll do grauitous shots and flattering angles but they take a much more cultured and dare I say artistic take on it.
>>503425346Semantics, I was just telling you the literal JP text>>503425404This is a Key game, not a WFS game. WFS put together the game part of it. Key is a visual novel company and they are very regarded..
>>503425560>very regardedvery retarded actually
Any chance of us getting special black friday packages/GSS? I don't know how Yostar operates at all.
It's like saying "Aniplex writes such good stories" when the original work was written by some fledgling mangaka.>>503425836You are? I'm sorry to hear that sis. Me too actually.
>>503425560This anon didn't play tomoyo after lmao
When did JP start getting actual character selectors instead of this shitty random 1 out 3 packs.
So tell me about this mermaid accident
>>503426090I actually haven't, but I own it. I don't really care enough to play it for Tomoyo, since it means Nagisa was left all alone.
>>503415605use the free ninja girl from the event. Her S form does shitloads of charge damage
>>503426318just pretend it didn't exist alright, tomoyo after DIDN"T happen.
Why are russians crazy
>>503420175I thought about it but I just can't go hard on the intro banner.
>>503426559is she supposed to sound ESL as fuck? Is that in JP?
>>503426513Yup, but I still wanted to support Key so I bought it.
Bros... My shitcoin pumped today. Leave server costs to me.
>>503426631She's a yandere. It's not ESL related at all, she's just having negative thoughts.
>>503423542>reddit buzzword garbageMouthfeel as a term has been around since the 50s. The line there gives you all the context for why they decided to use that instead of texture.
>>503426631That's her talking in her curse mode
>>503426714counting on you fren.
>>503417842Shoot. I am not gonna make it
>>503426714Buy me a pack, gro.
>>503423542getting angry at "mouthfeel" is not something that i have expected
>>503426884Get it done anon>>503423542>doesn't know english but still comments on the translationsI guess you're the "tranny" all along lmao
This character seems like a betrayal risk.
>>503427069She's literally fine, nothing to worry about.
>>503426832>>503426992>>503427023You will never use this word in a conversation. Give it up.
>>503426631>Is that in JP?No.>>503426830All of her dialogue is like the top line though, it's absolutely stereotypical eastern European broken English.>>503427176>You will never use this word in a conversation.Go back to >>503423542 and tell me what the last sentence says.
>>503427176I have and do, since I was born during the Reagan presidency and read lots of books growing up. A shame that you grew up as a retarded zoomer / ipad kid. Also don't use Karerin for shitposting, she's a sweet girl.
I used mouthfeel to describe the texture of food once in the current year.
>>503427410Based vocabularystacy.
>>503427269A product of the own translation affirms itself because of the translation? Because you could just use texture and the last sentence stays the same.>>503427373Full of shit.
>suddenly concertis this... kino...?
>Your seraph>Describe the mouthfeel of the last food you ate
guys stop... you'll bully him out of this thread...
Do japs usually use the English word "texture" to describe food? Assuming the translation is accurate about Monaka talking about using a word that she never imagined using before, then this is an okay translation.Imagine if someone said "I never thought I'd ever use the word texture when describing food...". It's such a common word in English when talking about food that it makes the line kinda weird.
>>503423598
So are you suppose to make dark bracelets to make it easier to farm devastating earrings?
Deforestation alert
>>503427546Well they could have used a word like 口当たり, but they chose to use the less common English loanword texture. Using mouthfeel instead of texture in English also achieves the same effect.>Full of shit.You're literally an EOP lmao.
Mouthfeel...
bun-chan, wakkie...
>>503427812thought you were supposed to not craft rings, but farm them?
>>503427812the bracelets don't matter much for boss fights cause most of your damage comes from skills, and bracelet only boosts your basic attacks.the bracelets are nearly mandatory for arachina fight though because it resists every non elemental attack so without the bracelet you can't farm overgauge
>>503427614Err seraph is just the character and not seraphim weapon right. For now it's TenneMy mouth was full of msg with a nice chewy texture. It's fried rice
>>503428018>rings>earringsESLsister....
>>503428054What's arachnid again? Or is it not in global yet?
>game has YuriMaeda why?
>>503428190its the gem fight that unlocks once you have 170 accessory score. it's for the 2nd page of accessory keys that give up to +15 in each stat.
Can this get any more gay?
>>503428230go play something else if yuri bothers you so much nigger, you're on our turf
>>503427546>Because you could just use texture and the last sentence stays the same.Do you think it's natural for a person to have never used the word "texture" before?
>>503428410Bro you missed the joke
>>503428357yes, i need to see them schlicking each other
>mini music gameholy SOVL
>>503428286Aiiie. Is this thing on a weekly timer? I've been lazy about crafting and farming accessories.
>>503428487it's a double entendre, my response is for both angel beats female lead haters and wlw haters
>>503428410missing the joke aside, it's just yuribait and not real yuri tbdesu
>>503428573>mininot a minigame at all. it's a whole mode and they have live mode events with leaderboards and it shows the names of top scorers.
>>503428687>yuribait and not real yuri>he doesn't knowguess you haven't actually read very far into the story then.
>>503427753Yeah, that's exactly the thought process here. It's a perfectly fine translation both in meaning and in tone. assuming the dialogue is otherwise accurate and the line about it being the first time using that word wasn't made upI'd say the problem is some retard equating a word he didn't know with reddit, but really, the problem is that the game has a bunch of other genuinely retarded translations in it and because of that people don't have faith in it and assume anything odd they notice is another fuck up. Dunning Kruger only gets half the blame.
im a male but i self insert as ruka
>o-outright love confessions are just yuribaitthe absolute state of hetcope lmao
Yuri is cringe, Ruka said so herself.
>>503428983Yeah, I am something of a lesbian myself.
>>503428983i self-insert into ruka if you know what i mean
>>503428983Ruka is male coded.
>>503428574nope the weekly thing isn't out for us yet. you can do that arachina fight anytime but its pretty hard to even start it without really good accessories or overlevelling.
>>503429375Dykes are a little masculine, so what?
I self insert as Yuki because I want Ruka to flirt with me aggressively.
>>503429181>Recommended rating >Your ratingPal...
I believe in the power of Lv 100 units
>>503429272i'm only half lesbian but i haven't had interest in dating men lately
>>503429579
>>503429181Sis just push the buttons at the right time. It's easy.
>>503429660
>>503429940yes yes please
>>503429940chat is this real?
>>503429921>autism
STORM VANGUARD MOTHERFUCKER!
worst feeling everis there like a list of random +1 triggers on dialogues?
>>503429579I believe in the power of Tama dps. Somehow she always gets the kill.karin SS1's skill that takes her off field for 2 turns? Now that is a damage skill
>>503430440Pretty sure no one knows about that reference here.
>>503430510>karinThere's no character with that name.
Nothing beats bath time.
What is going on
>invite a different girl to bath every nightwhat are they trying to tell us
>>503431104Cute cursor, sis.
>>503431362It is actually not the cursor. Probably just a graphic error
>>503427614soft, slightly chewy with a thin crispy outside, gradually getting softer thanks to a lot of moderately thick sauce with a lot of slow-cooked, supersoft meat in it, topped with sour creampotato pancakes with porkolt
Which skills will be good to use introjection on right now? I'm thinking Seika's thunder field would be great on her SS2. Kozue's SP battery could be okay, but I don't actually know when her skill evolution is coming.
I forgot what Key was known for. I was lulled into the sense of comfort with the slice of life stories
https://www.youtube.com/watch?v=xggG7M5BIXQ
>>503429181Sis?https://www.youtube.com/watch?v=ne7wAD2VUp0 This is my favourite song and it's pretty tough, even getting S on Expert is a struggle.
>>503431659who?
>"pacify"Oh no no no no no
>>503431735me! please watch it~
who do you want to be
bwos I suck at rhythm games...
>>503431906I AM Ruka
>>503431906Yuki is so packed
>>503431906Aoi. I want to go out like that but irl.
>>503431906I'm already Ruka and I'm on my way to fuck ALL girls in the school
>>503431906I always wanted to be a Tama
>>503431906ruka.
>>503431906megumi sex
I can't believe HBR ended
>>503431906I am literally Tama.
That Event was gay as fuck Also Kura ;_;
>>503432181If you find yourself alone, riding in green fields with the sun on your face. Do not be troubled, for you are in Elysium, and your already dead!
Just finished chapter 3. What a ride. Chapter 4 when
hope we get the summer memoria for her soon still not sure if i wanna use my cubes on her summer one or the unison
>>503432332That predatory look
Should I start reverting some units when they hit max level?
>>503432267Now do the epilogue event for more depression
Self sacrifice is cool and Yuki should stop nagging about it!
>>503423542literally go to ANY wine tasting festival and you'd kill yourself over reddit buzzword garbage
Charlotte collab when?
>>503432787Maeda only wanted Angel breasts.
I'm literally Nao Tomori
>>503432787having them in HBR with all their powers would defeat the meaning of Charlotte anime...
>>503432708ISHYGDDT
>>503431906Wdym? I am literally Koju.
Karen is Seele isn't she?
>>503432787Blonde sister is literally Megumin...
i can barely find hentai of this game :(
>>503433068>i seriously hope you guys don't try wines and beers made by people who live in your communityKys
>>503433230>SeeleWho? Speak English motherfucker
Is there a way to skip each students introduction when rolling? i know you can fast forward but then you have to accept the you're friends now popup everytime
>>503433230Karerin is Karen. Karen-chan is Karen-chan.
>>503433230
>>503433463Kill yourself, there aren't even 40 different characters and you want to skip?
>>503433463That shit was the worst part of rerolling kek
>>503433627I'm rerolling sis, so yeah i gotta click on each popup
>seriously rerolling
>>503433463Iirc, been a week now, but you can press ctrl to skip like a VN in stead of clicking top right, and then keep the mouse on top of the ok notification so it goes faster. Or you can even press enter? I don't remember on the last part.
>he's still rerolling
>>503433873Why can I hear this?
>>503432478do it once for each unit ur planning to use it unlocks a skill slot, after that only use it on waifus ur definitely planning to use in the long term.
>Rerolling at allMust suck living with mental illness
rerolling is pointless you can lower difficulty
>>503434002
>>503432671https://www.youtube.com/watch?v=qi1KSXGhCOE
what a dork
I am set for life, right?
>>503434002if you chose lower difficulty it bricks your account seed
>>503434163she will eat your exp
>Hating on rerollGODs>>503433721Don't listen to the haters, king. You reroll until you're happy. And when you get an account that's as good as you are, remember me, your friend. Then enter my referral code.a5lfxbi9chqnr3hg
>>503434252She can get a fatter bottom
>>503434163>S-rareWrong one lmao
>>503434302Isn't S the one that gives +1 sp to everyone?
>>503434253>defending rerolltranny dilationesports, not even once.
What did she mean by this?
>>503434253So most people did not finish chapter 2 yet. I am not that far behind.
>>503434002I've never seen this message because I never lose.When does it happen?
>>503434163>use her>dies in one hitshe’s misinfo>>503434410you need to limit break her three times
>>503434410not worth using a character slot for +1
I want a hardcore depressive black metal goth gf...
>>503434560Oh>>503434591Ahhh good to know before I invested in her. The tojo guide was recommending her in every team
>>503434002is this in story mode?
>>503434551Old screenshot. It's 3/5 now.
>>503434559You answered your own question sister...
>>503433243>tfw she was the better pair with takajou than the idol
How good is she?
im a male irl
wtf?Ruka isnt gay after all?
>>503434560On max lb she lives fine mostly. Most S styles generally start dying in endgame without max lb, that's just how difference in stats works.She is still broken though.
>>503434815do you self insert as ruka or yuki?
>>503434839Even I'll be creeped out by that shit.
>>503434640I'm a gloomy jiraikei metalhead nearly 40y/o hag, does that count?
>>503434736I am below average!I am also trapped in the side story since I don't know what it meant by 2 days
>>503434892ruka because I want to touch yuki's giant tits
>>503434785Top secret meta unit. Congratulations, anon.
Ok, now THAT was kino.
>>503434785her swimsuit is better
>>503434839>She things being gay means you'll consent to sex with anyone right then and there
>>503434839She's a glass cannon who flirts like hell but can't take it when someone flirts back
>>503434839It's kind of funny how Ruka has to play the "normal person" role in every socialization.
>>503435070Statistically...
>>503435070...yeah?
>>503434002doesn't work for nonstory boss fights which is where the metafagging pays off.
>>503435070Yes, gays are degenerate.
Actually, that's called being a slut...
>>503434743No, I meant in what fight specifically. Does it happen in any story fight at all? Or just bosses? Or some specific boss? That big plant ball one had a lot of hp and I think people without blasters could get stuck on it for a bit.
Chapter 3 is very weird. Ruka just outright dislikes Kura even though they already had a socialization unlocked.
>>503435089OI MEGUMIN
>>503435345Not true.
so when the harem mc is a guy everyone praises him but when it'a girl she's just a slut
>>503435708Yes?
>>503435708She is a slut and that deserves praise.
Ch3 post event Tell me Kura at least got to touch Mona-nyan lewdly in her life
>>503435187Breeders are way more degenerate.>Pollute literally everything with microplastic, lead, mercury, heavy metals>Reduce natural biodiversity by more than 70% since the start of the industrial revolution >Having unregulated numbers of offspring and increasing population density higher many times over what the local land can even feed via agriculture>Worshipping greedy money culture>Pretending climate change doesn't exist>Narcissists with money want to propagate this dysfunctional culture into space because we won't even be able to live on the planet in 300 years due to retardsBut it's obviously the girls having sex with girls who are at fault.
holy cute
>>503435708men and women weren't made equal.
>>503436358ok faggot
>>503436412I accept your concession.
>>503436358your axe wound is bleeding xis
>>503434815im not. so like how big is your... you know?
>>503436358>girls having sex with girlsHow? they can only do foreplay lol
>open game>remember I have to alt f4 in a minute
>>503436529sorry to hear your tranny surgery failed and you can't stop thinking about it, but luckily you can always give suicide a try.
>>503436736if oral and paizuri counts as sex then whatever dykes are doing does too
praising_jannu.jpg
>>503436736so how is oral sex sex?how is cybersex sex?how is clothed sex sex?how is butt sex sex?simple logical extrapolation tells us that if those are sex, then lesbian sex is also sex.
>>503436358higger, don't expose us like that
>>503437068Whoopsie gravy~
>>503436931The fuck is a jannu, nigger? Take your fucktarded memes back to whatever sewer you came here from
>>503436931Nice burger
>>503436358trvth nvke
>>503437436GET OUT OF /vg/
Should I play the sword event or the post ch3 event first?
>>503437595Are you lost? This is the Heaven Burns Red thread.>>>/vg/fgog>>>/vg/fgoalterWe don't talk about shit games here.
>Breakfast>Fried Chicken and Salisbury steakjaps are messed in the head
>>503437784>conveniently ignores the tranny chinkshit above
>>503437831seethe harder lmao
>>503437628Do you want small sad or big depression?
>>503437831Chinksis wasnt wrong though
>>503437968I already have both
>>503438270sis....
>>503438270Go for sword autism then, but probably do Kanata event first, since it references it.
Was Ruka a bad leader for sending her squad into the tunnels during an earthquake?
nice thread bros. must be sea hours.
Why is the alchemist so pissed off all the time?
Its been a long time my dimwit sister.
I can feel the spoilers coming, cya faggots
>>503434785I just got her, I wonder if I should be using her with her sister?
>>503438623Someone who wants immortality obviously has KeyAIDS.
What to do after some of my characters reached max level?
So 1186 gay slimes have died to defend humans?
>>503438813One keyAIDS was not enough for the team?
>>503438623All she wants to do is MAKE POTIONS, but the DUMB DYKES have DRAFTED HER TO THE FRONTLINES, far from her beloved POTIONS LAB, where she is forced to battle both ALIEN MONSTERS as well as MORE DUMB DYKES intent on ravaging her supple girl-flish.
>>503438854This is why you become a necromancer, not an alchemist
>>503438815Go outside, take a bath, brush your teeth, chores, laundry
>>503434839I am still surprised by how fucking gay Kura is for Monaka, how people are not talking about it
>>503438852You just cursed your account seed.
>>503438923It's not that hard, I don't even nolife this game
>>503438623Being a smelly femcel can make you mad
>>503439034>femcelOnly if she walks around with bear mace, given she is the most erotic creature in the whole facility.
>>503438975I don't like spoilering you newsisters so I only allude to it.>>503439008>All are S.Lvl 0That isn't max.
>>503439196Tell me how to raise that S.Lvl that's what I asking for
>>503439279Style exp books and earning enough exp to raise the style level.
>>503438992
>>503439305me n who?
>>503439343I don't understand, there's nothing I can do with the level beside pulling for dupes, tell me like I'm five
>>503439196I think most people have reached ch3 and past ch3 event given the frequent amount of mention it got lately
>>503438664hi...
>>503439609There are some retards still stuck on the rerolling part and two of my friends just started earlier today and they
>>503439740>theydefinitely browse vg.
>>503439584Oh, maybe you all don't have style levels yet
>>503439740>There are some retards still stuck rerollingThey are NOT retards, they aremy only hope to get 5/5 referrals. Please, bwos a5lfxbi9chqnr3hg
>>503440287LMAO
>>503440092Do you mean this blue level up?
Her mouth says no de gesu, but her body says yes de gesu
>>503440706Do not an imbecille, anon
>>503432486Which one? Kura event?
>>503440706Ruka talks a lot about infidelity...
>>503440870Ntr is hot.
>>503440287at least you got one
>beats girl at her own game>gets rewarded with flaunted nudity and a cute pet nameRuka is such a chad
When I look at the battle pass screen, it has login bonuses for 12 days, which is way too conveniently the exact amount of days that I can get login bonuses before the reset. I assume its hiding login bonuses for day 13-30 as to not scare me out of not activating the battle pass, right? Because I ain't buying that shit if I'm not getting the full amount from it.
There's an epilogue event?
>>503441018Do you mean you entered my code? If so, thanks bwo... I'm running arena right now so I can't check if people added.
>>503441397I'm dumb. I just had to scroll down far enough.
stop saying bwo zoomers
Kozue is so cute...
>>503441595Bwo... nya...
>>503441587I just started the event and I'm already sad
https://www.youtube.com/watch?v=9426YZBaqCESieg Heil?
>>503436358do chinks really....?
Noooo, I got the small sad now.
Dev stream?Roadmap?Next chapter release?
>>503442484Hmm yea yea, next month!
>>503442636eos?
>>503442484For every query of this, Yostar will throw more sponsorship money towards irrelevant e-celebs
are none of these bitches gay?have i been lied to?
There's no roadmap because they don't know how much money this game could make them yet...please support the servers, sisters...
Are you proud of me, hbr?
>>503443458nyo
>>503443382I'm sure they like girls too, but...
>finished reading chapters 3 event
>>503443647Everything will be ok...
Would you roll on Byakko if she were meta?
>>503444090I will roll her when she turns into tiger girl
>Make a good third of chapter 3 be about training for a bait operation while keeping a good security distance from the target>They don't use it to tire Monaka out of her berserk state and force Satomi to handle it aloneSometimes I feel like Maeda is way too focused on creating drama despite himself writing explanations why it shouldn't happen or perhaps he's foreshadowing possibilities for a golden timeline where no one dies.
Should I just use S tickets immediately, or is it worth saving them for anything?
>>503444934Anon have you forgotten that they were literally cornered on that section of the tower?
>>503444934She might have been too fast. Also, I think she was in between them and the big hole. There was also the other flathand to worry about. If Monaka attracted it with her sperging out, it could have been a problem. Sure, she might have been able to solo that too if she didn't exhaust herself swinging while it made its way over but yeah, they definitely should have considered it
>>503444934there was another one coming they hadn't the timeAlso given jun maeda's writing i'm fully expecting everyone whose ever died to come back to life.
>>503445428>Also given jun maeda's writing i'm fully expecting everyone whose ever died to come back to life.Yeah, that's why I'm talking about the golden timeline.>>503445292Yes, like you said, they are in the tower and they even made a point to say that Monaka's weapon isn't fit for indoors fighting earlier in the chapter, making it even more obvious to me that there's a way they could've exploited it
>chapter 3 event endingfuuuuuuuuuuuuuuck...
>>503446705Read the post event
JPbros... Are you guys able to clear the hardest of content with a non-meta team? I don't mind struggling, but I don't wanna be completely walled. I would happily just roll only on the girls I like if I can get by even the hardest content with them.
>>503446747Post event?
>>503446912The post-chapter event will be unlocked upon finishing the chapter, read it
i ran out of GP....
>>503446912read it alright while it hots! the one that's on 3x atm that unlocks after you clear ch3.
>>503447006Anon I've already cleared the Chapter 3 event, after the main story, what the fuck else is there
>>503446910Define hardest.Later story chapters? You don't need meta at all, just your teams functioning properly.High level optional content? No, you're going to have to minmax there.
>>503447016What are you even spending it on?
>>503447224accessory crafting... send help please i'm poor
Should I be doing events between main story chapters? The Mari and Ichigo popped up and felt like direct epilogues, but what about the other ones in the events page?
>>503447334In the OP anon.https://docs.google.com/spreadsheets/d/1DF7YWfm9ESpxbBVZEP1W7mIN8AByjsb-QzKLzYxVjgA/edit?gid=1600602704#gid=1600602704
>>503447016back to the shitty dungeon mines bwo
>>503447334The release order wasCh.1+Ch.2 > Mari > Ch.3 > IchigoSo you don't have to play them now if you want to do the chapter first. But you can if you want to chill for a bit.
>>503441096You get 30 days regardless.
>>503447214Yeah. I meant high level optional content. By minmaxing, do you mean extreme minmaxing where I need all the meta supports AND meta attackers or would I be able to get by with just the supports and some not so great attackers? For example, could I run thunder Yuki/Yuina instead of thunder Aoi?
>>503441630Thanks?
Now I'm glad I stayed up all night just to got this.
What even determines whether an event gets 3x bonus?
>>503445032There's no point in saving any of the 2nd gacha tab items since they never have pity nor apply to pity, which is what the 1st tab gacha has.
>>503447421Why did the retard who did it adapted the release order to EN? Just because it was bundled with the EN release does not magically change its original release date, which is the whole point of the release path, which follows the order in which things were released.
Is this worth running?
>>503447859I was thinking in case it would get updated with any worthwhile SS in the future, on the very small chance the roll gets it.
>>503447859but do permanent styles get added to the tickets over time
>>503447992Maybe if it has those gold sparkles, no idea.
>>503446747>>503447006He is talking about that event you idiots
>>503448104Do the dungeon pass work on other events? So should I save it?
>>503448197I'm pretty sure in your inventory they say that they're specific only to that event it came from.
>>503448260Ahhh. Might as well as run it then!
He mentioned it
>>503446910I am a casualhag and I am progressing (clearing increasingly hard content) at a pace I feel is appropriate for my amount of effort, player rank and setup (levelling, gearing, acquired units and all that) and I haven't been paying any attention to meta the past two years. There isn't really any hurry for anything especially for you ENs when you don't have anything "difficult" yet.
>>503447998Some of them expire, check if they have dates. S-rare or up and the story 10 roll tickets don't expire.
>>503448000No, new tickets come out. The ones where you need to collect 3 or 10 usually expire and the ones from monthly passes have a have rotations
>>503448684Ack, the pass tickets (rainbow color, requires 3) have rotations and expire a certain amount of time after you get the pass (like 6 months?)
>>503447845Did you recently clear the associated main story chapter?
which characters do I max out for clock tower?
>>503447662>would I be able to get by with just the supports and some not so great attackers?If your supports are good, then probably. It depends more on what you exactly have, and what your LB situation is, you will understand how it works soon.>could I run thunder Yuki/Yuina instead of thunder Aoi?You probably can play thunder Yuina. Her damage is a bit lacking on the higher level, but the later supports are so busted, it's probably enough. And even if you don't use her as the main attacker, she still can be used to build OD, DR and stuff. I kind of doubt you can play thunder Yuki there, but I never tried it, so I won't discourage you, maybe you can.
>>503448903Yeah I finished ch2 didn't get Ichigo's event 3x bonus, still only the Mari one
>>503448909Clock tower isn't hard, you can run whatever and see the enemy elements beforehand and set up to march.
>>503448998It triggers when the time for Mari's story completion bonus expiresIt's a retarded system
>>503449073That's weird
>>503448998Wait what? I have both Ichigo and Mari as 3x at the same time.
>>503448990Alright, thanks anon. I guess I'll just wait and see. Hopefully Yunyun comes willingly so I can roll on Yuki. I think another meta support comes right after her though, but oh well. Gacha's not worth playing if you don't dickroll once in a while
Just wondering, but the way they keep releasing new Aoi styles means this warning is just hypocrisy right?
>>503449770This warning is exactly what it is, it's just telling you the team you're playing isn't canon, nothing else.
Why does the wear the pimpcoat, bros?
lol my other gacha just leaked the EoS noticeHBR Please live
>>503450125wat game lmao
>>503449770Maeda can sperg all he wants about canon, but the gacha mob bosses run the show
>>503450162Alchemy Stars
RUKA CHAN SHOCK
>>503450125your fault for still playing AScool concept and art, but it was so fucking boring
>>503449770>Woke up>Logged into the game>Realized that I forgot to initiate auto battles in the power saver mode>Started crying a lot and tearing out my hairThe TRUE hbr experience
>>503450315They're gonna be saying that about us too if we EoS...
>>503450913Kinda yeah, this game has the same problem where the gameplay is assHBR has much better story telling to carry it though
FAT
>>503451006Gameplay is fine for a mobile gacha, it's not even a chibi slop. Many gachas with bad gameplay live for a very long time, it’s not about the gameplay, but about activity management.
>>503440961
>>503451006I like the gameplay, bwo... Buff stacking and nuking makes me cum. Hopefully it becomes more interesting though. Definitely feels very limited. None of the future memorias seem to do anything different. Just the same shit, but better. The bosses feel lacking in gimmicks too.
>>503451818>Buff stacking and nuking makes me cum.Did you enjoy Code Vein?
>>503451965I actually didn't. The areas all felt boring.
>>503451740I don't get it...
Just finished chapter 2.Damn.
>>503452241
>>503452281Seyana.
stop posting megumi it's lowering /hbr/'s iq
Epilogue ch 3 spoiler. This is the moment i broke
>SS from the daily pull>
>Skill settings / order aren't retained across multiple squads, any time you set a character in a squad formation you have to manually set them againFucking why?
>Roll hard on Seika 1 for introjection >Realize I'll need 29 SP from her to double stack SS2 buffs and set up the thunder field Hopefully it'll work out. I'm already bringing Kozue along. With her EX and OD, I might just get the buffs in a reasonable amount of time.
>>503453712if you want it to be maintained you can just copy formation
What bond 4, how the fuck I'm supposed to achieve that if there are no socialization events left
>>503454375Please wait warmly.
40 earrings crafted, only 2 with 1200 DP. This is what causes the game to EoS. RNG equips are always dogshit in every game.
>>503454650How to craft?
>>503454650there's no pvp or events with tiered rewards. relax
>>503454710Gem flashbacks, you unlock it near the end of chapter 3.
>>503454869>They didn't give us the option to lick Yukkie
newbie here, is it worth it to get ninja s shards from the event?also code 479kpd4fbgpw7k02. Havent used the friend code entry, will gladly exchange.
Anon with a bricked PC version here. My only other gacha that I've been playing is getting EoS'd soon so I'm thinking about finishing chapter 2, reading chapter 3 and all the available event stories on the current account and then returning with a new account (where I'd be able to skip all the story) next month since I already wasted all my rolls and several days worth of life stones. Sadly I'll have to play using emulator even though the PC version was working perfectly before.Would that be a good approach?
>>50345511314q1huo8kudpare3
>>503455116attached pic
>Completed the first chapter 100%>All activities>Dungeon>All bonds>All backgrounds>Still on ch.2 day 3Slowanons, I'm here.
>>503454436I'm okay, but why do I have to have a gimped character when all others are fine
>>503455116>>503455237I really do wonder what causes people to have problems like these. It's not like you can fuck up installing a game.Malware? File compression? C:\ drive shenanigans?
>>503455237Reinstall
How the fuck do these work? If I +4 it does it increase the hp-dmg %? +3 at 10% is shit
>>503455453I've already done every possible thing suggested here and nothing helped.>>503455449No idea. I've been playing it on my new notebook which I started using around the same time the game launched.
>>503455237Did you install it on an ssd or an hdd?
TEEESTICULAAAAAAAAAAAAAR TORSIOOOOOOOOOOOOOOOOOOOOON
>>503455591>New notebook Is it on windows 11?
>>503433230Seele!
>>503454650It was introduced to give people something to do while they stalled months for the new story chapters. Eventually you get max everything, they even introduce a system to upgrade items to max.
>>503455116I'm not looking into fixing this problem anymore. Just wanted to know your opinions on this approach. Another reason for starting on a new account only next month is that so I could properly use the free monthly passes.
>>503453367>got an SS instead of some A shit>still complains
>>503455836Should be, yeah.
>>503456005Just reroll a new account right now and use the free passes next month. Skip zoom past chapters you already read. I did this with my bricked no-reroll 30k quartz used account that got nothing. Made me cave-in and start rerolling.
Why does the gear guide say what earrings I craft don't matter and then later says I need 6 white earrings. Why wouldn't I just farm them right off the bat?
>>503456104Should be? Why do you sound unsure?
>>503455237Your download got corrupted, had the same issue. Uninstall and redownload again.
Is there a point of going further than 3rd floor in dungeons ?
...
>>503457004teardrop thing to unlock accessory stat slots when they're '?' on floor 5 after another miniboss
>>503456109I kinda want to read more story right now and I think that the teams on my current account are good enough to clear the main story fast. Sadly not solid enough to clear the top difficulty on events/score attack based on what I've seen in other clears on yt.>>503456327I've been using Win7 on my old PC and asked my friend to install the new system on my notebook.
Got Seika while dumping my Quartz on the release celebration banner so i’m happy now.
>>503456580Already did that too and didn't help. Tried to repair, tried to delete the Data folder and repair, tried to uninstall, reboot, install, reboot and launch.
>>503457127Whoops didn't get everyone in the picture here.
>>503457214That has to be a Windows 11 problem at this point. It shouldn't be too hard to "upgrade" to Windows 10. Just grab a USB and download it in there.
>>503457184Your Aoi?
>>503455268I'm still at chapter 1 day 9 and I'm a day 1 player
Where the fuck is the oubliette of tears?
>>503457689cocktower
>Chapter 2 endingWould've been cool if it hadn't been foreshadowed a hundred times. The twist during the epilogue was damn cool tho.
>>503457758>Unlock being able to upgrade tear stats after beating chapter 2>Don't unlock the game mode that gives you the tear upgrade items until after beating chapter 3
>missing a CG in chapter 2Wish the game gave me a clue on when this CG was supposed to show up.
>>503457789I don't think it was supposed to matter it being spoiled as JP trailer seemed to spoil that anyways
>>503458134OH NO NO NO NO NO
Which account should I stick with?
>>503458154Yeah it was basically spoiled for everyone before the game even came out. You had to go in completely blind to miss it.
>>503458245bottom for meta slavery
>>503458245bottom will make your progress easier.
>>503458134>missing a CG in chapter 2Bricked.
>>503458683Got it tho.
Are there any particularly plot relevant recollections I should do first? Also are there any I should avoid because they spoil content we don't have yet?
>>503458060I CAST UTERAL TORSION
I remember now what game this gacha reminds me of.FF type zero, kind of.
Is the fire attack from S Ruka decent so that I could use it with free SS Ruka?
>>503457017
>>503459031Absolutely. Its a good aoe for dungeons, which is something free Ruka is sorely missing.
>>503458134I think it would be better to put this link in OP so that people could stop asking about missing CGs.https://game8.jp/heavenburnsred/425634
I have like 50k gems now, should I go for Step up? I dumped reroll hell after a Seika/Ivor pull and haven't look back since Currently I am getting fucked by needing different shits than slash/ice
>>503459269Or was it that one?https://game8.jp/heavenburnsred/421208
>Can't beat the first fight in Ichigo's eventAh fuck, I didn't want to level her up.
>>503459393^-^
>Sugawara's bond event>Says we're going for a stroll>Figure I should walk to match the ambiance but Ruka keeps running no matter how lightly I tap on the stick>Wonder if the game is bugged>Continue the eventMAEDA PLAYED ME LIKE A DAMN FIDDLE
>>503459493Maeda seems to like doing the whole "this running gag is actually on purpose" for both comedy and drama.>Yukkie commenting on Bungo's words>poka~n
>>503459456Just use some books to get her to level 20.
>>503459493I rate you zerolita
>>503457660
Best frozen type lesbian for end game heterosexual content?
Oh for fuck's sake
>>503459743AHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
>>503459847Ruka-chan... shook!
hey. I just started your lesbo game.Is this fine to start with?I picked tama from the other selection ss recruit
>>503460021Yes don't get caught up in re-roll hell
Action nakige vn similar to this and rewrite? I feel like reading. But action... Not muv-luv
>>503459743Don't click this nigger's spoiler unless you finished Chapter 3.
>>503460071Honkai Impact don't touch the Martian shit its awful
>>503460021Yeah good dps and best tank for a long time. With Tama as a good healer for a long time. Only missing a buffer but you can try the 5 step-ups to round out your team more. Use my code bwo >>503395980
>>503459393Anons?
>>503459393150 to spark. HBR's income is rather meager by virtue of it being a Jap gacha.Save for a future banner that you want.
>>503460538do it and post results
>>503460538I will do it. Current progress is better than saving for God knows when.
>>503460665Even if I am getting fucked by any slash res stuff and can't farm things?
>>503460665Anyone really strong coming up? I kinda wanna dickroll but I read you can get stuck easily if you're missing key memorias.
>>503459393step-up is extremely worth it if you get lucky, mid if you don't. Having more usable SS characters is always nice.
Sumomo x Byakko (Human Form) when
>>503460846SS Yunyun in January, Angel Beats will probably be in February if it's not delayed.
>>503460846Cold steel (haha...) is out right now. 4 banners until super meta I'm not pulling because Angel Beats collab is 2 banners after Yunyun.
>>503460846>>503460834>Anyone really strong coming up?>Even if I am getting fucked by any slash res stuff and can't farm things?believe in urself!
Best way to level up a single character fast?
>>503461092>whole dungeon map has slash weakness enemies>boss is slash resistantMAEDAAAAAAAAAAAA
>>503461149Just beat it with willpower!
wait, is Ruka actually in love with Yuina or is Ruka just gaslighting her
>>503459393If you're a collector yes. If you're a meta faggot baby bitch boy then no.
>>503461393harem route. she will fuck all girls
>Tama actually carrying trash fights with her aoe slashlmao, nice healer.
wow, anon's not lying. Ruka really is an eroge protagonist
>>503451235Don't bully Byakko about her weight, girl tigers are still girls...
Ruka hasn't touched herself, confirmed
>>503461732Tama + Isuzu SS1 can reliably wipe creeps.
>>503462350>calling mobs creeps, a moba termkys
>>503461393She's a flirt. It's banter most of the time.
>I can finally play the gameYey! Only took like 30 accounts.
>>503462608good job bwo make sure to quit in 1 week
>>503462561Is that how you are coping Yuki?
>>503462727>>503462727>>503462727
>>503453367How about you get to know Byakko instead of being a bitch nigger like all the other retards whining that they got "knotted" by getting a female tiger who is distinguished enough to be in a Seraph Corps assault unit?
nyooooo, why is there more training in chapter threee
>>503462802>nooo why is the military doing trainingWhy are people so fucking stupid?
>>503462608Hope you hate it and fuck off in a few days.>>503459269>people could stop asking about missing CGs.People will continue to ignore the OP and ask retarded questions. It's just human nature at this point.
>>503462875You can hardly call it a military when there's no discipline.
>>503463279Oh so you haven't actually been reading any of the words in the story. figures.
>>503458920why not just get the memento for your SS units?
