>HEYYYY. Promote my frog posting guys
kys

>>25509896
N

Voices in the walls
My dog tried to rape me again
The end the end the

SCHIZUICIDE ON MARQUEE MOON SOON-I-CIDE
INSIDES OR OUTSIDES? MARE IMBRIUM MIND

This was posted on /mu/ in 2018
>Sittin on the can to escape the cubicle
>Chewin on my nails bleedin out the cuticle
>Drank too much coffee now I got the squirts
>Left untucked so I got a poopy shirt
>Smeared like brains on a toilet seat
>No salad for lunch so I'm eating raw meat
>Peter Piper sucked a pickled dick
>and the kicker is slick rick was a spic
>Frankincense and myrrh
>Public lice and fur
>Shit on my hand
>I'll go in for the shake
>Put my finger in your mouth
>Like a crossword puzzle answers
>In a swastika shape
>Ape rape grape tomato juice labia

File: 1776780691554210.jpg (136 KB, 1280x840)

136 KB JPG

I have been to the land
Of a thousand thousand moons
Where the cocodrill and
The scarlet mandrake's evil runes
Rule the hills with impious
Impudence and fire bees with
Garnet wings go screeching
In the violet sky tumultuous
And the moons are keeping
A roaring silence worse than death
I have gazed on the azure moon
The emerald moon of glee
But the evil moon at noon
Which you will never see
It followed me through gulfs of thought
And from the world of dreams
Its icy light from worlds forgot
Is still tormenting me
Verminous worms and lice
Are spawning from that deathly light
They're gnawing at my bones like mice
In drywall walls at night
The million moons are calling me
They beg for my return
But you'll go in my place my friend
Their beckoning I spurn
But worry not, your life won't end
Though you begin to burn
The flaming stake will take you there
That multicolored land
The moon of noon goes with you where
Together you will stand

File: the_best_of_amp_08_mauve_blood.png (568 KB, 2563x1649)

568 KB PNG

>>25509896

File: the_best_of_amp_12_dream_poem.png (583 KB, 2563x1649)

583 KB PNG

>>25510455
and

’Twas brillig, and the slithy toves
Did gyre and gimble in the wabe;
All mimsy were the borogoves,
And the mome raths outgrabe.

“Beware the Jabberwock, my son!
The jaws that bite, the claws that catch!
Beware the Jubjub bird, and shun
The frumious Bandersnatch!”

He took his vorpal sword in hand:
Long time the manxome foe he sought–
So rested he by the Tumtum tree,
And stood awhile in thought.

And, as in uffish thought he stood,
The Jabberwock, with eyes of flame,
Came whiffling through the tulgey wood,
And burbled as it came!

One two! One two! And through and through
The vorpal blade went snicker-snack!
He left it dead, and with its head
He went galumphing back.

“And hast thou slain the Jabberwock?
Come to my arms, my beamish boy!
O frabjous day! Callooh! Callay!”
He chortled in his joy.

‘Twas brillig, and the slithy toves
Did gyre and gimble in the wabe;
All mimsy were the borogoves,
And the mome raths outgrabe.

The lock clicks, and I can hear each component part becrying your leaving
Your flight goes in three hours - it's on time
Two - the door's still closed
One - I'm still awake
The night has just begun, and you left your last line
Your plane departs, and I think I can hear it softly whir, taking you south for the winter
That lock - I can still hear it click - sounded a little like your phone's buzzing
But that I heard a lot, and each time a door closed
With a name writ on it
I type one in, no results of note
I go to your Twitter, like so often
Who is that following you - don't I know that name
I hammer in the moniker
There's a camshow
Do you know him?
Now that you've left, have you called him
When he looks into the camera, does he see you?
Does he see me? There's a camera above my monitor
Click
You wouldn't film me for this guy's sick pleasure
You're not sick like I am
You wouldn't hide a camera here somewhere
I gave you shelter and besides
You're not awake like I am - you left your last line
If you had - click - it would be somewhere there, in the shadows, or that ball of light
I can find out
Need to shut off my phone
Anything in there would still work, though
Why is everything - click - so loud all of a sudden
Who said that?
I turn slowly, and there is a man
A man with a big knife
A big, bloody, searing knife
What did you do?
I stumble back
There is no man
I look in the mirror
There is no man at all
You've got me, I think, looking at the camera
You've made the colors louder
Click
This will be a long night
But I will prevail

I don't think there's any beating CAS's Hashish-Eater. It's way too long to fit the whole thing in a single post.
https://en.wikisource.org/wiki/Ebony_and_Crystal/The_Hashish-Eater
Bow down: I am the emperor of dreams;
I crown me with the million-coloured sun
Of secret worlds incredible, and take
Their trailing skies for vestment, when I soar,
Throned on the mounting zenith, and illume
The spaceward-flown horizons infinite.
Like rampant monsters roaring for their glut,
The fiery-crested oceans rise and rise,
By jealous moons maleficently urged
To follow me forever; mountains horned
With peaks of sharpest adamant, and mawed
With sulphur-lit volcanoes lava-langued,
Usurp the skies with thunder, but in vain;
And continents of serpent-shapen trees,
With slimy trunks that lengthen league by league,
Pursue my flight through ages spurned to fire
By that supreme ascendance. Sorcerers,
And evil kings predominantly armed
With scrolls of fulvous dragon-skin, whereon
Are worm-like runes of ever-twisting flame,
Would stay me; and the sirens of the stars,
With foam-light songs from silver fragrance wrought,
Would lure me to their crystal reefs; and moons
Where viper-eyed, senescent devils dwell,
With antic gnomes abominably wise,
Heave up their icy horns across my way:
But naught deters me from the goal ordained
By suns, and aeons, and immortal wars,
And sung by moons and motes; the goal whose name
Is all the secret of forgotten glyphs,
By sinful gods in torrid rubies writ

I have voices in my head
I wish that I was dead
from 12 am to 12 pm just lying in my bed

I love a woman's butt
When she sits down,
That's where she puts all of her weight.
I want that weight on me
I want to lift it and make it weightless
I love a woman's butt

Oh I'm glad this thread is up.

I need to write a character who has "the crazies" and I figure you people would be the right people to ask since y'alls seem to have more experience than me. This might be good inspiration!

>>25512333
What type of crazy

>>25512372
Well, just give me an example of your day to day or things you experience. I don't know all of the """"types"""" so I'm just hoping you say something that catches my attention.
:)

>>25512400
I don't anymore but I used to interact with a lot of recovering meth heads for work. They have a pretty wide variety of crazy. The most interesting are the recovered 'sane' ones who function fine in society but believe in free energy or anti-gravity technology. Its always one of those two ideas. You can have a normal conversation about something else and then they'll start telling you about if you take apart a washing machine you can make infinite power with the motor and they're one calculation away from getting it. But it ranges from that to rolling around in the gutter while telling imaginary people to fight each other.

>>25512415
And...what's your personal experience with being a crazy weirdo?

>>25512433
I've been stalking my ex for 3 years. I don't even like her and I'm engaged to someone else, its just a habit at this point. Other than going past her work or her apartment and watching her social media and all that I'm pretty normal.

Do the dogs know,
What is obvious to us,
That these fences are just a facade,
That the things which truly bind us,
And them,
Are more metaphysical,
More esoteric,
Or maybe,
It's the dogs who know better after all

A slide projector clicks behind the vitreous humor:
Mother is thirty, breathing, unbroken, remaining.
Father stands in the yard, holding the season by its collar.
A small boy sits on the porch steps, believing
in an architecture of becoming.
I had sketched a shape for myself
in the margins of an open century.
Then the calendar stripped itself down to bone.
Milestones passed like mile-markers in heavy fog
stamped papers, polite handshakes,
faces deleted from the register, lowered into lime.
One day the optic nerve simply turns on:
the horizon is only baseboard and drywall.
I am not an inhabitant; I am an aperture.
Identity registers at zero.
The world narrows to the gray slab:
three crushed filters, spent paper,
a smear of soot and ash drifted into the seam of the curb.
An empty sidewalk, stretching cold and dry.
I watch it from ten feet behind my own eyes,
untouchable in the glass bell of the head.
And then comes the breach.
Not grief, not sadness, nothing
An alien kinetic weight.
Anger does not belong to me, yet it arrives,
heavy, muscular, a foreign iron
that splits the sterile perimeter of the self.
It drives inside with a raw, phallic violence,
colonizing the quiet rooms, privacy
planting its boot where the numbness used to sit,
claiming this hollow domain as its own.
The glass shatters inward.
The watcher is dragged across the threshold.
The waft catches an ugly heat,
and in that sudden, suffocating tear
I am occupied.
I am engulfed.
I am FUCKED.

>>25512498
so you were molested by your dad. sounds like it hurt

>>25512499
Only metaphorically.

>>25510358
That just sounds like a Death Grips parody

File: aaa.png (83 KB, 194x256)

83 KB PNG

whoops!
wrong thread

Bathing, bathing, ok, soap.
Towel but later.
What if the boiler falls.
Slippy feet are not,
standing on the rug.
Tickles but painful
from perineum shaving.
Ah, water.

Hey guys
It's time
Tune in
TV static
staccato jazz hands blue glow
a silhouette waving at nobody
behind the fake balsa wood paneling
the termites eat the foundation down to soft flour
thousands of blind little jaws
marching on instinct
chewing damp pine in the dark
they work for the queen mother
spinning jenny spits cheap sparks in the dark
crabgrass outside
in the bathroom, plastic daisies hurl outright in the bowl
swirling down the cracked porcelain
with the bleach water, spit, and a drowned pantry moth
flavored like piss and banquet gravy
a bad baptism under the watchful eye of fluorescent light
the linoleum is sticky where the grape crush soda died in July
on the counter:
a slice of fried bologna sweating on a paper plate
Oscar Mayer weiner
grease cooling into a thin white skin
inject statins in my dickhole
Grandma’s synthetic blonde wig sits on the injun scalped head
the screen door hangs by one rusty screw
signs of elvis and rip johnny doo
flapping against the drywall every time the interstate trucks shift gears
Jon's got a lazy eye and a purple scab on his shin
eating a frozen waffle straight from the cardboard sleeve
His fingers are gray with bicycle grease
Leggo my Eggo
Hang on to your ego boy it's all you got
He stares at the screen where dreams used to live
The radiator rings and dings like a doggie chained crying out for help
In Jessica's front yard, the deflated plastic kiddie pool
Ticky tacky pink flamingo pattern
holds four inches of black rainwater
and an aluminum can of lukewarm liquor
No one coming by any night no big time boogie nights
just the compressor kicking on in the Frigidaire
the quiet chewing simmering buckshot
chewing the cud
something up tell mom that
and all that jazz
blood spit jizz noise all part of the soul
rendered the same in the end
waving goodbye to a life that was already condemned
Amen

>>25509896
The birds are real
They're pecking in my head.
Faster, faster,
They peck at my brain.
They're in my head.
They're eating my brain.
Peck, peck, peck, peck.
They won't find the worm
I've hidden it deep
The secret place
Where their beaks can't reach
The madness
The horror.
Peck peck peck peck.
I am not your lunch
I AM NOT YOUR LUNCH

sneer sneer, meaer
him weyo over the heyo
5g nice for HIM SPOHEYO
LO WEYOIL GATES IM CUMMING THE LOST WHEN MAYO 10 SHINING ONES
HIM HE SPEAKS

I dew it. Fuck leotard. You slipped.
Why not. Stitched cunt open.
Eh I suppose now, but before you shout.
What that wall so high I can't hear you.

My dick is hard but I can't cum,
Her body is warm but I can't cum,
The dog is watching but I can't cum,
I turn the webcam on but I can't cum,
Trannies in the chat but I can't cum,
I post on 4chan but I can't cum,
Oh shit wait,
I'm cumming

i suck penis
it makes me gay
is being gay ok
the state says yes
jesus says no
so who is to say

>>25512690

i was reading the monitor text
when splurt, text unseeneable
mommy handkerchief
if you dont know how to clean
you just make a bigger mess
cant find the tab now
that one page 403 porn vid

>>25512695

if you love the man
attached to the penis
youre gay

myself stretching out
Black burns edge inside
And the rhythm syTts again
What do I know of
England
Who I've never known in dreams
And the blood of Owain Glyndŵr runs hot and endless down my arm across my chest and into the Seax buried in my heart and whereas into me against my will brytthonic filth brownred besmirch a swordman
Henry
Cruel joke. I know what you're doing. I understand more than we all let on. I know what you did and where. I know how.
Cymru am byth
Cymru Nebraska
Dulce est decorated with inside out

I do love you all and I will cry bitter tears of dun salt at our all passing may they etch my bones forever and I miss you so so so so so so much and always will have

Hellfire
Apache
Psychic
Turnbull
Integration
Clitical analysis of gay sex

Penis weapon sonic attack drive eardrums into and the skull limpid which is what want you came here for and it's me for you and then the comes after and it then afterward is but no not yet and the yes comes before we all get on the floor cloaca dinosaur

>>25512695
Surrending to lust in general is sinful whether it's being a faggot (gay) or being a faggot (giant impossibly fat female asses) (my current primary vice)

>>25512333
https://en.wikipedia.org/wiki/Alexis-Vincent-Charles_Berbiguier_de_Terre-Neuve_du_Thym
https://de.wikipedia.org/wiki/Ludwig_Staudenmaier

GOD = current ET
because ET is not alien it's Eternal Time, Encoded Truth, Engineered Thought
and yes God On Demand.
Not a being, but a state

File: 2273741-HSC00001-7.jpg (198 KB, 770x1154)

198 KB JPG

**hypervirus eats the end**

whatever ultramodernity cages under signs
postmodernity uncoils as virus

culture leaks into partial-machines
no womb no autonomous spawn
semiotics collapses into virotechnics

0010101011011100101101010101001100100010001010
yes no yes no yes yes
no longer what does it mean
how does it spread

having no proper substance
only re re re replication
the word virus is more virus
virus virus virus virus virus

fanged noumena
3 8 3

hypervirus eats the end of history

hype trades on what it will be
virtual fashion on off
self-fulfilling prophecies
anticipating a trend accelerates it
recursive trend
sf collapses into catalytic efficiency
tomorrow rerouted through today’s prospect

everyone will be doing it

virus: parasitic replicator code
asignifying sequence
machinic data flow-break
on/off 1/0 yang/yin
destined for war

no message-content
only intruder passcode
locational zip
pseudogenomic junk
garbage scrapcrapcrapcrap

biovirus hacks cellular dna
ATGACTTATCCACGGTACATTCAGT
enzymic cut-and-paste
reverse-transcriptase clicks
endocellular computation begins

ethnovirus brains
technovirus production
infovirus computers
010010010001011110100001001101010101010

hypervirus targets the immunosecurity structures themselves
yes yes no yes no
nomadic abstraction across media
dna words bits symbolic models
folds into itself
involutes plexes
reprograms the reprogramming of reprogramming

rom melts into recursive experiment

recording devices
copiers faxes samplers
k-stammer ((re)re)reruns
orphan drift
repeat infection

all strains plastic interoperative

insert hyper-prefix
tag tag tag
transfer into abstract nonlinear machinic systems
tuned to virtualities hyperspeeds
futural currencies independent of defuturalization

going hyper dissolves being into activity
on off on off
material desubstantialisation

spreads like heraklitean fire

(no analogies
no metaphors
in hyperspace)

virus virus virus virus virus virus virus
the chatter continues
the end is already infected

>>25513127
i think this wins

in the morning, cut a watermelon

and there was my head,
she successfully realized herself
in a sealed place
but speaks the watermelon language

and I was studying the melon language

Yuri Rydkin

Stop rhyming last word of every other line.
That isn't poetry.
Try alliteration for once in your life.

>>25512821
7.5/10, very nice

When i was in psychosis everything i said was a riddle

File: 716653b8d666ad6670f1f5b3e(...).jpg (94 KB, 736x981)

94 KB JPG

>>25512667
Metal.

>>25512821
8/10. Mathcore.

>>25513127
9/10. Unhinged. Deserves to be growled over distorted guitar polyrhythms.

>>25513725
Meant for >>25513127? I don't see math in what you quoted.
>>25513127
This is the best thing in the thread as far as poetry and skills goes but it's kind of coherent.

>>25513746
Yeah, "hypervirus" more strongly merits my mathcore comment but when I wrote that I hadn't seen it yet.

File: 7e57531a30f7e0a957300f6e6(...).jpg (197 KB, 621x597)

197 KB JPG

thos adds plant noise to forestall
pulls your will
askess
undress the blind girl
thisgirl thisgirl thisgirl thisgirl
BreatheBreath BreatheBreath
BreatheBreath BreatheBreath

don't fear time
breathe her breath Comanche
strappado swills your lying corn
tomorrow she will die

>>25513746
"Mathcore" doesn't mean actual math. It's a genre of music.

pescio vivo senza nuote.
aqua scurra. co minerali.
en piato con patates giali.
manca forcheto.
pago solo par guardar menu.
uomo di soleze viene:
chiede.
Io profeso, bel menu,
prendo pescio di garmeli
senza che brucio.
/
fisher alive without swimies.
cloud water. with minerals.
in the plates with yellow potatos.
fork is missing.
pay only to staring at menu.
a man of solaces comes:
asks.
I profes, good menu,
i take the garmeli fishio,
don't burn it.

Rain, rain, line, another line.

Tree near the tree, another one.

Balloon pops, finger went places.

Fox and bear, move along.

What's that, honey plays.

I don't.

But rich soil is full of worms.

Sneaky little bum cunts.

Sleazy little elephant skinned wonder.

Wood politics. Shit smeared on the leaf.

If the tent is placed near the stream

you don't smell it.

If you throw up it's Autumn stained.

File: gandalf.jpg (27 KB, 539x320)

27 KB JPG

>>25509896
The Exquisite Nigger

He wakes up already dressed,
For he does not need clothes.
He exits his tent to defecate,
And outside is where he goes.
He grabs his sharp stick,
For that is what he knows,
As he pokes the standing cow,
In a place where nothing grows.

All dressed up in clothes
Reading, writing, prose
Basic civility, computers
Is too much to impose

And that's okay
Cuz that's the way he is
But people don't know
Who the exquisite nigger is

bump

>>25513127
hey i was gonna post nick land :/