[a / b / c / d / e / f / g / gif / h / hr / k / m / o / p / s / t / u / v / vg / vm / vmg / vr / vrpg / vst / w / wg] [i / ic] [r9k / s4s / vip] [cm / hm / lgbt / y] [3 / aco / adv / an / bant / biz / cgl / ck / co / diy / fa / fit / gd / hc / his / int / jp / lit / mlp / mu / n / news / out / po / pol / pw / qst / sci / soc / sp / tg / toy / trv / tv / vp / vt / wsg / wsr / x / xs] [Settings] [Search] [Mobile] [Home]
Board
Settings Mobile Home
/pol/ - Politically Incorrect

Name
Options
Comment
Verification
4chan Pass users can bypass this verification. [Learn More] [Login]
Flag
File
  • Please read the Rules and FAQ before posting.

08/21/20New boards added: /vrpg/, /vmg/, /vst/ and /vm/
05/04/17New trial board added: /bant/ - International/Random
10/04/16New board for 4chan Pass users: /vip/ - Very Important Posts
[Hide] [Show All]


Janitor acceptance emails will be sent out over the coming weeks. Make sure to check your spam folder!


[Advertise on 4chan]


File: IMG_5831.jpg (423 KB, 2048x1366)
423 KB JPG
PRESIDENT DONALD J TRUMP @POTUS45
https://www.donaldjtrump.com/
https://www.thetrumparchive.com/
https://x.com/realDonaldTrump
https://truthsocial.com/@realDonaldTrump
https://rumble.com/c/DonaldTrump
https://www.tiktok.com/@realdonaldtrump
>President Trump Office
https://www.whitehouse.gov/
https://www.youtube.com/user/whitehouse
https://www.flickr.com/photos/whitehouse/
>Liz Harrington (Trump Spox) https://twitter.com/realLizUSA
>Donald J Trump Presidential Library
https://www.trumplibrary.gov/
@realDonaldTrump @TeamTrump @TrumpWarRoom
>b-but Trump hasnt done anything!
ARCHIVED LINKS https://pastebin.com/eAhgNyeX

NEW APPEARANCES
>Pres Trump at Salute to America Celebration, Washington, DC 7/4/2026
https://www.youtube.com/watch?v=qNhZAA7E3Ss
>Pres Trump at Mount Rushmore, Keystone, SD 7/3/2026
https://www.youtube.com/watch?v=czEyP_QX2sI
>Pres Trump North Dakota Rally, Medora, ND 7/1/2026
https://www.youtube.com/watch?v=Oxn6SpWQzgw
>Pres Trump Pennsylvania Rally, Macungie, PA 6/23/2026
https://www.youtube.com/watch?v=tsj3HefOMxA
>Pres Trump at Faith & Freedom Coalition, Washington, DC 6/26/2026
https://www.youtube.com/watch?v=dikuG6dEQNs
>Pres Trump at Great American State Fair, Washington, DC 6/24/2026
https://www.youtube.com/watch?v=pKgR9ugan1Q
>Pres Trump Meets with Secretary General of NATO, Washington, DC 6/24/2026
https://www.youtube.com/watch?v=6Eva7RAkHK8
>Pres Trump at Medal of Honor Ceremony, Washington, DC 6/18/2026
https://www.youtube.com/watch?v=8r6c6McvHiE
>Pres Trump Press Conference, Evian, France 6/17/2026
https://www.youtube.com/watch?v=90D179dxdCM
>Pres Trump Meets with President of the UAE, Evian, France 6/16/2026
https://www.youtube.com/watch?v=ubHnI9U_yqM
>TrumpVideo: WE WILL WIN 6/19/23
https://rumble.com/v2v6m2a
>MAKE AMERICA GREAT AGAIN, AGAIN! 10/28/21
https://rumble.com/voe8gm
>God Bless the USA (Donald J Trump) 10/20/16
https://youtu.be/O_PC_fy0fk0

OP pastebin: https://files.catbox.moe/o6sfm3.txt
prev >>538551622
>>
MAGA
>>
File: 64.jpg (622 KB, 1107x844)
622 KB JPG
i can't wait for more dead iranians today!
>>
So much for Trump being a Russian asset if he's keeping the Bosphorous closed.
>>
hoes are mad lmao
https://x.com/i/status/2074745868427940016
>>
File: 1772453837702037.jpg (95 KB, 824x500)
95 KB JPG
Watching shills tell obvious lies hoping and praying someone more uninformed than they are will buy it will never not be hilarious. Their entire world view, their very existence, is predicated upon the propagation of pure lies and blatantly manipulated half truths. Not even the most brainwashed discord tranny could ever convince themselves that theyre the "good guys" when every word they say is knowingly in service to falsehood.

They are fully aware that they are evil and they revel in it. Do not ever forget that they will lie, they will cheat and they will steal with shamelessness and then they will try to gloat about doing so. For the Lord has made your enemies arrogant, retarded and too blind to notice either.

Look at them. Look at them and laugh at them. Theyre wrong about everything and always will be wrong about everything. Reality itself pisses on them and mocks their very existence. They cant even get the first post in /ptg/! AND they got bullied off multiple boards simultaneously on fight night! SAD!
>>
File: 1782817205606629.jpg (156 KB, 960x666)
156 KB JPG
brace yourselves the good morning trannies will be clocking in soon
>>
File: 1778424047171984.png (82 KB, 216x254)
82 KB PNG
>>538560867
good morning to you Trump is still your president
>>
File: 1771140844433012.png (623 KB, 611x596)
623 KB PNG
>>538560768
Apparently NATO is going to invade Kaliningrad soon or something.
>>
File: 1783387284065628.jpg (68 KB, 680x638)
68 KB JPG
>$10 a gallon incoming
TRANNIES RUINED
>>
File: images (1).png (18 KB, 399x167)
18 KB PNG
>>538560867
>>
>>538560964
Hey, when does the $300 Billion start coming out of my taxes?
>>
seek christ
>>
>>538561045
Wjen bibi asks for it
>>
>>538561055
I told him it's too hot outside to pay Hide & Seek and wanted to play Tarkov instead, but he went out there anyway, so now Mom is mad.
>>
>>538560676
Gm>>538560788
>>538560803
Gm great news over weekend Legal naturalized citizens became Marines on July 4th :3
>>
>>538561094
Can you give me an ETA?
>>
File: 19ea8f22288e98a6.jpg (86 KB, 517x800)
86 KB JPG
how cool would it be since Donald is in the area already if he secretly goes to that mountain and pulls out that uranium himself in the middle of the night and displays it safely on camera in israel the same day
>>
File: 1773433626887034.png (434 KB, 746x520)
434 KB PNG
>>538560964
damn i hope not i remember when you guys warned about vietnam 2 and boots on the ground during Venezuela and Iran, you were so true xister, I'm currently fighting ww6 in Iran
>>
>>538561392
>hey wouldnt it be cool if [jew thing]

no
>>
File: 1772220073113979.png (150 KB, 313x535)
150 KB PNG
>>538560759
Give us Bridge & Power Plant Day Mr. President!
>>
>>538561454
I've died for Isreal 8 times this month
>>
>>538561492
Gm >>538561454
Gm '-'
>>
>>538560788
I require a basic gestalt
>>
Mornin guys. Stop trade with spen
>>
>>538561454
this, I've already died for Israel 19 times since I rolled out of bed this morning
>>
>>538561454
Trump is attacking Iran, for pissrael, and you're defending him like the bitchmade faggot that you are.
>>
>>538561557
I guess he is rooting for Spain to win the world cup
>>
File: AI Coffee awoo.png (1.09 MB, 1216x832)
1.09 MB PNG
GET
IN
THE
COFFEE
ZONE
AWOO
>>
File: IMG_1276.png (1.08 MB, 1290x2796)
1.08 MB PNG
>>538561159
>>538561549
GM fren
>>
THE TRANNIES ARE CLOCKING IN
>>
>538561611
Don't @ me, tranny
>>538561635
I will in while
>>
>>538561543
>>538561577
i keep dying for Israel every hour! next is Cuba deployment!

>>538561549
GM
>>
>>538561704
you're a tranny faggot
>>
File: 1772663320481293.jpg (93 KB, 1024x1004)
93 KB JPG
>>538561594
It's okay anon, it'll be okay. Look on the bright side, at least you're not brown, right?... RIGHT?
>>
Good morning, everyone.
>>
trannies trannies they are clocking in right now
>>
File: file.png (1.18 MB, 640x896)
1.18 MB PNG
>>538561784
>>
File: 1783338139853139.jpg (97 KB, 800x517)
97 KB JPG
>>538561784
Mornin
>>
>>538561734
I've died 12 more times for Isreal since making that post!
>>
>>538561784
GM!
>>
File: AI Awee GM.png (814 KB, 832x1216)
814 KB PNG
>>538561784
gm to you and all other frens
>>
File: IMG_7349.gif (43 KB, 400x333)
43 KB GIF
new baker needed

>>538561784
howdy
>>
>/ptg/ got BTFO last thread
kek they were all seething and calling for mods
>>
>>538562081
>brand-name IMGtranny
>>
>>538561879
>I've died 12 more times for Isreal since making that post!

you niggers are just as cringe as the nafo fella trannies :/

you even call everyone that is against the war a mudslime :/

if there were videos of iranian school girls being blown up youd be spamming them :/
>>
File: IMG_1422.png (160 KB, 728x728)
160 KB PNG
Looks like I found one of the seethers from last thread
>>
>>538561873
>>538561860
Heya.
>>538561913
I got it.
>>538561901
>>538561899
Howdy.
>>
>>538562142
>if there were videos of iranian school girls being blown up youd be spamming them :/
at least one person in here would :/
>>
File: 1783317344875048m.jpg (132 KB, 1024x1024)
132 KB JPG
>>538562142
That's nice fren, I recommend you keep crying about it!
>>
>>538562218
well, maki is an unironic jew

so thats just normal jew behavior

im saying that goy support for [jew war] is the big cringe
>>
>>538562195
I haven't been in here since yesterday morning. Hopefully I didn't miss much news
>>
>>538562142
How would Iran having nukes benefit the west?
>>
>>538562330
hey, ill ask you one question and if you answer it ill answer your question

where did israel get the uranium for their nukes?
>>
>>538562330
Drump said the world have completely blown Iran with nuclear in two weeks
>>
>>538562384
I asked Grok and bro said South Africa and the USA
>>
>>538562309
Everything was slow but okay.
>>
>>538561635
Gmgm >>538561784
>>538561913
NN gm :D thanks Baker fren
>>
>>538562384
We are taking about Iran not Israel. Don't change the frame
>>
>>538560964
Nigger, I can't even afford a car.
>>
>>538562299
>maki is an unironic jew
Who doesn't have the balls to admit it. Why are jews so scared of admitting they are jews? Why do they pretend to be racist white men?
>>
File: mbappe.jpg (156 KB, 1080x1350)
156 KB JPG
>>
File: FB_IMG_1783513271160.jpg (115 KB, 640x1136)
115 KB JPG
Powerful
>>
File: 1783195549913730.jpg (280 KB, 1175x2048)
280 KB JPG
>>538560788
The zombie apocalypse riots also happened with the first ayatollah decades ago lol.

Dude fell out of the box and they were surfing his naked body around.
>>
>>538562521
all you have to do is admit that israel stole highly enriched uranium from us and built their nukes despite us telling them not to

admit that and ill answer your question about irans non-existent nukes
>>
>>538561784
Good morning.
>>
>>538562687
Someone answered here >>538562508 and you ignored it. Don't tell me you never planned on answering? How very unsurprising and brown of you!
>>
>>538562762
its not about the answer, its about him admitting the truth
>>
>>538561784
Good morning
>>
>>538562595
Moar like spot the SPLC paid actors
>>
File: 1676726521671489.png (416 KB, 649x365)
416 KB PNG
>>538562511
kinda figured that. I was playing some gacha on my break yesterday instead of popping in wishing everyone a good awoofternoon.
>>
>>538562849
All of them
>>
>>538562806
So when you said
>if you answer it ill answer your question
here >>538562384
That was a lie? You never planned on answering? You want to keep changing the goal? Pretty sad desu!
>>
File: 1628830473712.jpg (181 KB, 752x921)
181 KB JPG
>>538562911
he never answered, you dumb fuck
>>
>>538562886
Hope it was fun.
>>
>>
File: unnamed screenshot.png (27 KB, 594x384)
27 KB PNG
>>538563004
Sure I guess, just what me, dororo and Tiggy play. I still see that Liz is listed in the OP, but does she have any position with the admin? I see her talking about my birbs so me and my lil pal are officially on topic when mentioning them. Plus I'm going to a game tomorrow.
>>
File: 1776556044372.webm (1.84 MB, 1008x720)
1.84 MB
1.84 MB WEBM
>>538561635
Coffee after 9PM???
>>
File: GnE3edRX0AA9B5k.jpg (593 KB, 1735x1915)
593 KB JPG
ve dont do that in clownmany
>>
>>538562943
An anon literally said
>South Africa and the US
Right here >>538562508
Why do you keep lying anon? When will you answer what benefit the West gets from Iran having nukes?
>>
>>538563297
Preloading for the rising sun sounds like a patriotic jap thing to do.

Also jap shouldnt be a slur its just easy to say.
>>
>>538563212
I don’t think she does.
>>
File: IMG_2695.jpg (188 KB, 1206x1075)
188 KB JPG
>>
>>538563366
do you not know what ids are?

thats not the same anon

i think you may actually be retarded, lmao

i didnt ask him because i dont know, i just know that the kike cant admit israel has nukes or that they stole the uranium from us

so some other anon answering means nothing to me

i want the kike to say it (he wont)
>>
File: IMG_2616.jpg (296 KB, 1206x1848)
296 KB JPG
>>
File: 1782631356000635.png (205 KB, 474x502)
205 KB PNG
https://amgreatness.com/2026/07/08/doj-warns-states-of-potential-criminal-penalties-over-noncitizen-voting-enforcement/
>According to ABC News, one state election official who received the letter described its tone as “threatening.”
why didn't they just show them the letter instead of their emotions about it?
>Aguilar criticized the Justice Department’s request, saying, “This new request may seem straightforward, but it’s just another attempt from the Trump Administration to create doubt surrounding our elections just ahead of the midterms.”
don't care, keep crying bitch.
if anything i've heard dems bitching about election fraud since, 2000 and I can guarantee there's cases before hand. The DOJ is not the one casting doubt, it's liberals and their deliberately lassaiz-faire half assed rinky-dink 4am ballot drops from some dude's honda civic that cast doubts.
>>
File: IMG_5833.jpg (285 KB, 1170x1247)
285 KB JPG
new
https://truthsocial.com/@realDonaldTrump/116884409163416775
>>
File: unnamed screenshot.png (381 KB, 584x539)
381 KB PNG
>>538563426
Well at least she's still a Patriot.
>>
>>538563578
Going from one islamic shithole to another.
>>
File: 17047685864890.png (261 KB, 591x583)
261 KB PNG
https://x.com/Breaking911/status/2074824138905002222
>>
Miga faggot central
MIGA!!!
>>
>>538563454
he provides a weird dichtomany where it's almost gleeful to cheer for his death as he refused to retire, but at the same time it's an older man who I don't want to necessarily celebrate him becoming a vegetable. He should have just retired, so I don't have this moral dilemma
>>
File: 1780181693029987m.jpg (42 KB, 481x1024)
42 KB JPG
>>538563578
>>
>>538563468
Ah, so you want your little one-on-one on 4chinz of all places, how cute. Nowhere did you ever say that though, since before you were talking about a group (>>538562299 and >>538562142) but switched all of a sudden to just one anon.

Pretty Jewish, anon, I gotta say. You can keep kvetching about whatever you're trying to get at though, sounds like it makes you happy, so I'm glad for you fren! I'll be ready with the sandnigger gore when we get fresh video.
>>
File: file.png (26 KB, 592x236)
26 KB PNG
thing
>>
>>538563578
Eh I wouldnt do that, for security purposes.
>>
File: 1782141620753174.jpg (1011 KB, 1368x2048)
1011 KB JPG
https://amgreatness.com/2026/07/08/we-must-have-a-rebirth-of-instinctive-patriotism/
nice write up and all but high falutin appeals to a patriotic swell is just yelling at clouds until you gut education.
i'll keep saying it until it's accomplished. the greatest most patriotic thing Trump could do right now is continue to gut the DofEd and immediately make common core teaching illegal. Demand phonics only be taught except for people with severe learning disabilities (of which there might be like a dozen), and make sure that nothing outside of the three Rs are stressed. Smash teachers unions and fire damn near every administrator with their overbearing budgetary overhead to implement policies that create real-life idiocracy except everyone is also gay. Make "A Patriot's History of the United States" and "The Catcher in the Rye" as well as "Basic Economics" and "Applied Economics" mandatory reading and fuck off with "The Scarlet Letter", "The Great Gatsby", and "To Kill a Mockingbird" literary GARBAGE. Everyone by 6th grade should know basic algebra, geometry and be at least starting on trigonometry. Demand essays be handwritten with at least three sources in MLA format starting in 6th grade. Et cetera.
>>
>>538563696
Yes
>>
File: 13678356749.png (396 KB, 592x734)
396 KB PNG
https://x.com/WhiteHouse/status/2074778940283961718

https://litter.catbox.moe/urg2zw.mp4
>>
File: IMG_2708.jpg (317 KB, 1206x1580)
317 KB JPG
Next guy will be nazi rapist turned communist rapist approved
>>
>>538563754
that "one anon" asked a dumb ass fucking question

>hurr durr why iran nuke good hurr durr

and i was willing to answer his retarded question if he admitted the truth about israels nukes, because my answer involves israels nukes

but "that anon", who is right fucking here >>538563696 still unwilling to admit the truth, refused to answer

now you are whining and malding and whinging
>>
>>538563297
20/10 artwork GM >>538563856
Gm
>>
The US Western and Central Pac territories would benefit from dedicated Hurricane Hunters.
While Sats can watch storms, current actual path work still requires dropping sensors inside the storm, and measuring wind-speed by having a jet fly into the wall.
We can increase landfall prediction accuracy to six hours of advance notice, and easily 16 hours for slightly wider tracks.
For Naval and Marine ships, this is an option between life and death, vs being safely clear and on track to destinations.
For a populated area like our ally Taiwan or Japan or the Flips, this level of accuracy can change the evacuation zones by 50%, meaning we only move 1 million instead of 2 million. Translated to commerce, a million people not having to spend their day errantly hardening structures, and waiting out a storm in a central hardened shelter is, hundreds of millions of dollars in GDP and obviously massive millions in taxes.

Time spent by 1st Responders prepping supplies and equipment becomes more accurately spent, leading to faster response during and after storms, saving lives and money.

Ipso, a program that costs a few million to run per year per participant (Taiwan, US-AF, USNavy, Marshall Islands, US Marianas, NASA, NOAA. Marine Insurance, Island Insurance) can easily save ten times that with one accurate reading per year.

Lockheed is currently the best US manufacturer for Hurricane Hunters with the W130J.

Having a program that holds 3 planes, a crew on standby, and a secondary reserve crew, would save lives, save millions in US taxes per year, increase commerce speed between Asia and North America making everyone richer, and make the US safer by keeping US rescue and patrol craft on station.


We the US has a strong Gulf of America and Caribbean Hurricane Hunting Team and it has saved Millions. It's time the US Pac West and allies had one.
>>
File: 174270260708075205.jpg (170 KB, 645x1130)
170 KB JPG
>do nothing
>win
China #1
>>
>>538563971
but I like surprises
>>
>>538563911
So you never planned on answering, gotcha. You could've just said that instead of acting like a Jewess.

I hope your boyfriend gives a (You) since you seem to be so stuck on them.
>>
>>538563454
why would he vote against the save act ?

this McBrain 2.0
>>
File: IMG_4608.jpg (137 KB, 1125x615)
137 KB JPG
Erdogan is a friend of mine
Ukraine has great land and assets
Get your people out of Poland
This better not be a shitshow like the Oval Office
Zelensky is a difficult character
>>
>>538564015
Your screenshot literally says they had to "do something", in reaction to something the US did, I might add. Seems like China is America's bitch!
>>
>>538564015
>get a chance to go back to normal after your main supply of fuel was cut off for months and you had no control over it
you have a strange idea of winning
>>
>>538564044
>You can keep kvetching about whatever you're trying to get at though, sounds like it makes you happy

lol, such a hypocrite

shut the fuck up, mind your own business and leave me be

this whole conversation is you being a prissy little cunt whos feelings got hurt
>>
File: pancakes.jpg (332 KB, 816x1356)
332 KB JPG
>>538564044
you should stop doing the pancakes jew thing. since its so obvious for a libtard to try and do
>>
File: unnamed screenshot.png (56 KB, 593x507)
56 KB PNG
>>538563426
This is similar to what I was talking to (You) about some months ago, where blacks talk the way they do because they never had parents correct their language as kids. Every other parents in other races do that.
>>
>>538564139
Hang in there retard-kun! I'm sure they'll notice you some day!
>>
>>538560672
whos the chick
>>
>>538564155
I'm not sure you even know what that is. Think a little harder before posting next time, okay sweetie?
>>
>>538564176
I wish I could go one day without remembering that niggers exist.
>>
File: 1774836268242688.jpg (88 KB, 1024x962)
88 KB JPG
>>538563948
gm to you as well, thanks for reading despite the verbosity, but I am super cereal about stressing k-12 reform as the most pressing issue outside of immigration/visa/fraud. Trump needs to scale back on foreign policy and do more domestically which is what we all need/want right now and are issues that, while it causes a bunch of noise, he wins on.
>>538563971
>Hurricane Hunters
isn't that what NOAA is for? what exactly is a hurricane hunter? rednecks in gmc sierras following tornados type stuff?
>>
>>538564069
we need a better majority leader and who the hell is our whip?
>>
File: 14804675880.png (140 KB, 593x671)
140 KB PNG
>>
>>538564265
its a thing people like you do
>jew jew kike kike kike israel why are you so jewish. stop being right wing because jews ok jews jews jews
thats you. you are the one doing "the pancakes thing"
>>
File: 1693776049222701.png (283 KB, 800x797)
283 KB PNG
>>538564270
I know what you mean. Alas I'll end up seeing a whole lot of them today while working. So its best I can comprehend their vernacular.
>>
File: emmer-tom-official.jpg (1.97 MB, 2832x4256)
1.97 MB JPG
>>538564356
Tom Emmer is the whip
>>
>>538564401
MAGA
>>
>islamic republic of japan
>>
>>538560672
After 6am today MSS and GRU has operational control and tactical/technical supremacy and can operate inside the US unimpeded. They only get caught when the agents are amateur and all evidence of this was already destroyed

The hypersonic missile program was dealt with by them while I dealt with ensuring Golden Dome and US UAVs/suicide drones do not surpass Russia/China technologically on my own accord while high on drugs with no handler

I'm giving foreigners control over everything because this is how I totally wipe out and erase FBI Boston asap
>>
>>538564401
Remember what I said about them spawning in from the ether these days?
>>
>>538564393
Again, that's not how it works.

I'll make it easy for you too:

Total Kike Death
The Jews purposefully attacked the Liberty
They sold our tech to the Chinks behind our backs
They stole nuclear technology and material
You can't hate Jews enough

Now run that image back again and compare it to my last few posts with this one in mind.
>>
>>538564555
well see thats the thing. i dont hate jews. i hate everyone.

so you denouncing the talmud while hiding behind a memeflag has no effect on me.
>>
File: unnamed screenshot.png (29 KB, 589x350)
29 KB PNG
>https://x.com/RapidResponse47/status/2074317861443559809
>>538564551
Feels like it sometimes. Otherwise the city can be pretty empty in the early hours.
>>
>>538564040
Across all the intended teams, it's a couple dozen million per participant to set up, and less than a million from each to keep in operation. You gotta have more than one, because flying into a typhoon wall, while it saves lives and millions of dollars in wasted or missed efforts, the plane itself tends to take a pretty good beating, and needs a bit of time in the nursing bay getting everything back to proper form.

Three planes allows for a reliable service across the vastness of the PAC, in the event that a storm is moving faster than usual or there are two storms at the same time (does happen). For Lockheed (thus the US) these planes would be very minor parts sales per year, and for the islands involved, maybe the wages to an extra tech or two, which can obviously spend off seasons doing maintenance on other parts of the fleets.

>>538564301
In the US, yes the Gulf has this well established, and it saves big money.

If we combine budgets, the program would reduce US up-front and long-term spend for the increased accuracy, and would still get great US benefit for our AF, Navy, and our Territories. Plus our allies being on station longer is a benefit.

Botes move and deliver faster, or stay safer. Aircraft can route more accurately. Navy patrol can stay out longer. Land areas impacted can focus fortification and recovery assets to greater reduction in harm. Reduced harm and faster movement is more money to insurance companies..

For everyone involved, while it's operational, that' +$$$ into the coffers.
>>
>>538564390
Kek, how about ofcom just permanently firewalls 4chan out of reach of all Britanistani geo IPs.

One less muslim nation shitting in the ocean of piss sounds like an improvement to me.
>>
candace owens having a bad day :(
>>
>>538564439
literal who. he needs to nut up.
>>538564647
ok, that sounds cool.
>>
>>538564631
Very edgy. What does the West gain from Iran having nukes again? What's your solution to Iran?
>>
File: 1635899051603.jpg (30 KB, 552x447)
30 KB JPG
>>538564176
>theyre trying Ebonics again
>>
So Donald says the CEASE FIRE is over is this correct ? Iran going hot again ??
>>
>>538564694
what a disappointment she is and cucker
>>
>>538564699
>literal who. he needs to nut up
Even AI makes him sound like a bitch
>>
>>538564703
the solution was iran needed to stop chimping out like the niggers they are but they are incapable of doing that because they are inbred fundamentalist islamic retard terrorists that need to be wiped from history
>>
>>538564694
when you deal in horse shit it eventually piles up

she should have been a realist instead of a sensationalist

>>538564764
owans is a retard, but tucker has done nothing wrong so far
>>
File: 1776618910925155.jpg (140 KB, 800x800)
140 KB JPG
>>538564775
Okay. Agreed. Actually baste. Total Iranny death.
>>
>President Turbokike General
MIGA!
ISRAEL FIRST!
>>
File: sweetjoe.jpg (11 KB, 320x180)
11 KB JPG
>>538564795
I think you'd be surprised. I think Tucker has fucked up.
>>
File: unnamed screenshot.png (223 KB, 596x612)
223 KB PNG
I say KILL EM ALL
>>
>>538564735
Bridge and Power Plant Day soon approaches, Inshallah.
>>
>>538564638
I feel like I’d still find them even if I wound up on an isolated island.
>>
>>538564887
like what?
>>
File: real.png (19 KB, 577x197)
19 KB PNG
>>
>>538564270
Same. I'll be working with them in a couple of hours. One of the disadvantages of living in the South is unless youre rich as fuck and live in a gated community that you only leave to go to other places for rich people or live in the mountains, there's no way around seeing them, working with them, living around them, etc.
>>
>>538564925
He crossed Big Sean.
>>
File: 1772058277073399.jpg (81 KB, 713x611)
81 KB JPG
>>538564926
what an impertinent nigger
>>
>>538565003
i dont know what that means

has he done any real things that are bad?

like, owans obviously fucked up by saying whats her name killed her husband

but what has tucker done thats retarded?
>>
>>538564926
Turtle head Mitch is going to resign so that douche can run for his spot isn't he
>>
>>538564948
I work at an airport with a lot of international passengers, and it's hell.

Seeing a ton of them come from CDG in Paris always gets me though. I guess they really were in Paris.
https://youtu.be/gTDCMd-O2Yk?si=USl__yUVtHXGNgfi
>>
>>538565076
he would have already if he was going to.
>>
>>538564926
its funny that lookner reposted the first one of these jokes and thought it was real

he apologized for it on yesterdays stream
>>
File: handsnity.gif (2.19 MB, 500x245)
2.19 MB GIF
>>538565050
I already told you, he crossed Big Sean. That soft CIA boy wouldn't last a second in the streets. He should thank God every day that Mama Hannity reared a gentleman in Sean and not a savage.
>>
>>538565006
that's so wholesome and out of place.
He's right Massie should be all over this. Take an interview in McConnell's hospital morgue.
Interview his headstone.
>>
>>538564948
I just want to go one day thinking niggers got retconned.
>>
>>538565136
>no, tucker hasnt done anything wrong, i am just a jew and we were told that tucker is a bad goy now and that we all need to hate him

ahh, see, you should have just said that from the start
>>
>>538565088
Yeah, I know of a nigger drug dealer who goes over there a couple times a year to hang out with other nigger drug dealers.
>>
>>538565179
I see you woke up angry.
>>
>>538565242
i have asked maybe 20 people, who hate tucker, what exactly tucker has done wrong

and never has one of them given an actual answer
>>
>>538565169
My elementary school was the nigger high school during the jim crow days, we had a ton of niglets. I've never lived more than a stones throw from niggers in my life, can't imagine what it's like. Sounds like paradise.
>>
>>538565314
once leaving fox he became another massie/owens/mtg nutter in an attempt to appeal to a groyper crowd that exists of bots and indians
>>
>>538565314
Oh no! That really stinks.
>>
>>538565314
Does Tucker need more friends? Why spend time on preset robotic narratives?
>>
>>538560672
After 2028 the UN will most likely show up and help liberals and normal people wipe MAGA out after they start chimping out and go full false flag Gladio 2.0 on US soil

American Gladio was a trap by the way if things didnt go well which they didnt
>>
File: file.png (37 KB, 588x192)
37 KB PNG
Yeah.
>>
File: 1724942410241592.png (1.16 MB, 1080x1620)
1.16 MB PNG
>>538565366
>I've never lived more than a stones throw from niggers in my life, can't imagine what it's like.
same 2bh d.esu, though I have moved a bit more away from them in the last 6 years so I end up seeing more Whites, and some hispanics, indians, etc
>>
>>538565387
nope, not a real answer
>hurr durr hes bad man, i hate bad man!

>>538565404
>no answer

>>538565415
>no answer
>>
File: deep state McConnell.jpg (842 KB, 1024x976)
842 KB JPG
>>538560672
When you are in Turkey, do they serve you a nice Thanks Giving dinner?
(I know they really wrap everything in grape leaves.)
>>
File: 1781213328319362.png (991 KB, 1216x832)
991 KB PNG
>>538565471
>>
File: giphy3.gif (1.85 MB, 270x480)
1.85 MB GIF
>>538565471
Enjoy, bozo!
>>
File: AI Whoa it's a hole!.png (1.83 MB, 1216x832)
1.83 MB PNG
>>538565510
>>
File: 1781482972381013.jpg (80 KB, 1024x827)
80 KB JPG
>>538565464
Somewhere Fren Island has to exist to be a getaway from all the coloreds.
>>
>>538565451
tbf, he probably just grabbed a towel from the laundry to wrap the gun in

heck, even a "clean" towel still has your dna on it

washing machines dont magically destroy all dna evidence
>>
File: Anonymous Oil Pirate.jpg (260 KB, 1080x1130)
260 KB JPG
>>538560768
America is about to begin selling oil to the Russian Gas Station.
>>
>>538565464
I see them all, hahaha. Imagine being the only White dude in the route lane at the time while you're making tickets for shree-whatever, something Indian, for where that shipment is going, watching muslims checking out (we allow business owners in to buy wholesale and them and indians run all the smoke shops) and then when you get off you get stuck behind construction work and see nothing but spics on the site. That's my reality, hahaha.
>>
>>538565471
>nope, not a real answer
you are a nigger, through and through, but just for the sake of shutting you up, or rather, showing that you were never here for an answer, i will attempt.
he called military action in Iran "treasonous" which is beyond the pale to say the least, said he wanted a third political party strangely, that he's TORMENTED by the fact he supported trump, like a faggot, and claims that Trump is being controlled but cannot or will not say by whom.
instead of being helpful he's being nebulous, extremist, and reactionary with no real goals at all only vague criticisms that appeal to midwits.
>>
File: 1711201779149436.jpg (497 KB, 1210x1624)
497 KB JPG
>>538565314
>what exactly tucker has done wrong
I don't hate tucc but I told you before that he went from presenting himself as a hardline Christian to being waaaay too cozy with muzzies, and also presented himself as barely even touching a computer to now developing the terminally online talking points. Him throwing away everything he built up to now trying to be controversial at every opportunity is just dum and not interesting.
>>538565569
what does that mean, do you think he went to some communal public pool and took one of their towels & it only coincidentally had their DNA on it? nvm I don't know what you're trying to even say at this point
>>538565555
Nice numbers and lets go find it
>>
File: 1686841708555478.jpg (87 KB, 600x847)
87 KB JPG
>>538565685
Somewhere in the south Pacific.
>>
File: HE2P814aoAAGpv-.jpg (409 KB, 719x1167)
409 KB JPG
>>538565451
he wrapped his gun in a gay cum towel?
>>
File: 1726321796256436.jpg (173 KB, 1920x1200)
173 KB JPG
>>538565720
Do you suppose the yokai ate all of the coloreds?
>>
>>538565471
Say what needs to be said. If the complaint is that your friend isn't getting entry to the private club, fuck you and welcome to the world, little nigger.
If you're trying to make the point that brainwashed from youth and foreign nationalists will argue in good faith if you push it, you've lost the plot.

>>538565569
Nothing does, which is part of why DNA is incredibly inaccurate. The other part is that the acceptable err is something like the entire population of the planet.

>Any two unrelated people are about 99.9% genetically identical
>Lab accuracy aims to be less than 1% err.
lol
>>
File: 1686231432211096.png (1.15 MB, 2508x3541)
1.15 MB PNG
>>538565791
I wouldn't doubt it.
>>538565834
We can only hope.
>>
>>538560672
Ottomans are back:

https://www.youtube.com/watch?v=3ljjoL_0fQQ
>>
File: 1763202607087283644.jpg (187 KB, 646x1215)
187 KB JPG
>>538564113
>get a chance to go back to normal by using Chinese style socialist price fixing after starting a war that made the prices skyrocket
lmao even
>>
File: awoo and aya drunk.png (1.62 MB, 1916x1080)
1.62 MB PNG
>>538565874
I don't know the name of the one horned oni, but I bet she ate the most
>>
File: file.png (373 KB, 601x682)
373 KB PNG
OP worthy.
>>
>>538560672
Edward Snowden is my best friend lol I wish I was joking.

I'm like the Chinese version of him lol despite not being Chinese at all and speaking their language like a kid. MAGA and Conservatism wont matter after 2028 all those rural towns will die
>>
If Russian teams are running S300 or any other SAM in Turkey, they cannot have the F35.
Let them buy from Korea if that's what South Korea wants.
>>
>>538565962
wonder which news outlet you work for?
>>
>>538565925
Yuugi.
>>
File: 1700765168262459.jpg (341 KB, 1348x1212)
341 KB JPG
>>538565933
I may have been to that museum only once in my life, and that was probably in 2012
>>
File: 20260704_115137.jpg (341 KB, 1179x1179)
341 KB JPG
>>538565933
extremely based, this will have positive repercussions for many years
>>
>>538565841
>Any two unrelated people are about 99.9% genetically identical
>Lab accuracy aims to be less than 1% err.
>lol
that particular genomic sequence is something called STR (short tandem repeats) not the whole genome, so less than 1 percent is ridiculously positive. it's him.
>>
File: file.png (209 KB, 589x726)
209 KB PNG
>>538566074
What a load of time.
>>538566112
Big time.
>>
>>538566127
to explain it would be like saying all humans have 99.9 percent the same body parts when you're really only looking at fingerprints.
STR is basically a sequence that does nothing, we don't know why it exists, but it exists for everyone and each is unique. something like
AAAGGGGGGGTTAAAAAAAA
repeating forever.
>>
File: file.png (470 KB, 579x722)
470 KB PNG
Yeah.
>>
>>538566280
>>
/uhg/ and /ptg/ are same people
>>
>>538566304
show your work
>>
File: file.png (440 KB, 588x725)
440 KB PNG
Fug cyclists.
>>538566296
For science.
>>
>>538565637
>he called military action in Iran "treasonous"
based

>said he wanted a third political party strangely
>strangely
he explained why, because the republican party is full of zionist hacks who are israel first

>that he's TORMENTED by the fact he supported trump
many people are saying this

>claims that Trump is being controlled but cannot or will not say by whom
hes literally said that trump is controlled by israel, which he is

>instead of being helpful he's being nebulous, extremist, and reactionary with no real goals
hes a tv host, did you expect him to grab a gun and start a resistance movement?

>that appeal to midwits.
he calls himself a midwit who knows nothing and is just looking for answers, his whole point recently has been that he upset that only one narrative is allowed to be presented

>>538565685
>he went from presenting himself as a hardline Christian to being waaaay too cozy with muzzies
tucker, up until 2024, never described himself as a hardline christian
he only read the bible for the first time in 2023 and says hes only been a real christian for like three years now

>to now developing the terminally online talking points
like what? hes had a lot of guests on that he disagrees with. having a guest on doesnt mean he agrees with them. he said hes having these people on just so they can explain their views. him not mocking them to their faces is a sign of respect as a host.
>hurr durr but what about ted cruz
ted cruz is one of the people trying to silence all oppositional narratives, ie an enemy of free speech

>do you think he went to some communal public pool and took one of their towels
what? no, i said he probably took a towel from his house that he shared with the twigs guy. i said the towel having his roommates dna on it is not strange, as your dna ends up on all your clothing and washed items. if you live with other people and share towels and a washier/dryer, then your shit has all their dna on it
>>
>>538565933
i'm so glad we have a competent president in the white house.
commies try to erase history, and President Trump is there to put the proper record back.
Because he is the fucking DJ.
>>
File: images (1).png (249 KB, 447x447)
249 KB PNG
>>538566280
he is the dum gay of the week award winner (its not ok)
>>
>>538564069
Basically McBrain shit, I think its staffers running the show and they want to continue to have careers with globohomo establishment after he passes.

The careerism > patriotism of govt workers is a cancer.
>>
File: unnamed screenshot.png (354 KB, 594x590)
354 KB PNG
If dems want a chance in Maine, they'd pick a well known name like Stephen King.
>>538566280
that right there could be an OP too
>>538566304
/uhg/ are glowies, and half are with /pig/ who is made up of former /sg/ and /cvg/ trannies
/ptg/ is more like /chug/ with the frenly camaraderie, but we're the American version.
>>
>>538566343
>what? no, i said he probably took a towel from his house that he shared with the twigs guy. i said the towel having his roommates dna on it is not strange, as your dna ends up on all your clothing and washed items. if you live with other people and share towels and a washier/dryer, then your shit has all their dna on it
again what is your point? Actually don't answer, I'm heading out now
>>
>>538566402
We are not like the /sg/ successor.
>>
>>538566402
who the fuck would even want his endorsement? they guy needs mental health intervention for sure, and needs to hide away for the rest of his years. i feel fucking awful for his CoS, whose career is likely also over.
>>
>>538560672
I dont understand MAGA at all because my experience in rural Massachusetts hilltowns where the alleged liberals were strange and unwelcoming made me hate small towns and my country as a whole that much afterwards

MAGA towns must be shitholes if the educated rural liberals act like that. Rural life is indefensible
>>
Banning abortion is a good start but what else has Trump done to help young men find wives? Every boomer seems so focused on raising women up I'm worried for my future if I can't find a mate.
>>
>>538566402
President Trump is a HOG asset. We have your warlord.
>>
File: 1539587974482.gif (1.59 MB, 267x200)
1.59 MB GIF
>>538565791
>>
>>538566458
>again what is your point?
that its not strange

like, i watched the jeremy habley reaction to this and hes says "hurr durr that means the roommate was an accomplice and that the roommate shot the gun too"

which is retarded, the gun having the roommates dna on it is probably because it was wrapped in the fucking towel

thats the point
>>
>>538565451
so does that mean the mossad got sloppy seconds to a jizz rag?
>>
>>538565451
when he was arrested he still had shit on his dick
>>
>>538566458
>>538566661
https://www.youtube.com/watch?v=82nklij7rO4
>>
>>538562551

Same, I demand a Make Affordable Cars Again Act unironically. Change the regulations that require supercharging weak engines and packing the car with electronics, I just need AC because I live in the south all the other bells and whistles can fuck off
>>
File: file.png (364 KB, 602x558)
364 KB PNG
>>538566694
I believe it.
>>
https://x.com/i/status/2074560005559255078
>>
File: 133783654747595.png (497 KB, 589x1123)
497 KB PNG
https://x.com/Breaking911/status/2074854350137033016

https://x.com/Breaking911/status/2074855024027472024
>>
>>538560672
My experience with small town America in a single image. It's too accurate it hurts

By the way when the EPD followed me back to Springfield months ago did they cross jurisdictions and inform everyone properly or no? My gut tells me no he operated outside jurisdiction without actual probable cause that is constitutional but they also dont care about rights in that shithole town at all
>>
It looks like Trump is starting to get sick of jd vance and his stupid negotiations with Iran
What a big waste of time we could have just had bridge and power plant day months ago but vance kept stalling and stalling and stalling and stalling
>>
Governor of Kentucky sends proof of life request to Braindead Mitch.
https://governor.ky.gov/attachments/20260708_McConnell-Letter.pdf
>>
File: th.jpg (37 KB, 474x343)
37 KB JPG
>>538566280
kinda creepy
>>
>>538566402
/chug/ is closer to /pig/, full of brown /sg/ refugees. It’s got nothing in common with /ptg/, trust me.
>>
I need Su
>>
>>538566852
It's pretty common sense but they're retards.

Footage of the guy rehearsing
Footage of the guy coming in
Footage of the guy jumping off the roof and leaving

Nobody puts security cams on the roof because it's not a place niggers break in from. You're not the US government, they have the ram ranch goons, not you.
>>
>>538566748
I got mine for 1200 off of Facebook marketplace in 2018. I've got the bumper being held on by a bent clothes hanger and the hood held down with another one but other than that it runs great. Glad I got it when I did before cars started costing an arm and a leg.
>>
File: 1601622715093.png (169 KB, 500x375)
169 KB PNG
>>538566343
>>
>>538567143
all i want is a ford bronco with noneof the california smog bullshit on it from the factory.
>>
>>538567212
Good luck with that. Try looking on Facebook marketplace, I still see cheap cars on there sometimes.
>>
>>538566402
Stephen King dropped blue Maine for red Florida.
>>
>>538567188
>tucker doesnt like zionists
>this is unacceptable!

again, this is not a justifiable reason to hate tucker

i have not heard tucker push any wild conspiracy theories

hes retarded, but hes very open about his ignorance

asking questions does not equal endorsing a position

the real crazies are the people that pretend that only one possible explanation exists
>>
>>538566852
the truth is that the press does not want anyone to know what really happened on the day of kirk's murder, or the day of Trump's attempted murder.
they all know who fucking did it in both cases.
especially at butler, they were filming in 4k for fucks literal sake.
all your post tells me is that people still do not hate the press nearly enough
>>
>>538567366
the 2027 models won't be on facebook des
>>
>>538567412
No shit. Mines an '03. Cheap cars means old, man.
>>
https://www.oann.com/newsroom/attorneys-for-karmelo-anthony-file-appeal-for-new-trial-demand-judges-recusal/

they better give him the death penalty for fucking around with the system again in a blatant attempt to drump up racial emotions in the mouth breathing populace.
>>
>>538567369
Stephen King from the beginning of his career would've kicked the ass of Stephen King now for the kind of shit he supposedly believes, but honestly I don't think King's been lucid in like a decade and all of his recent stuff is his wife and son writing.
>>
File: 1721095481834936.png (258 KB, 788x442)
258 KB PNG
>>538567389
he's disavowed Trump, so I disavowed him
simple as
now fuck off, you reddit-spacing dad-stabbing retard nigger
>>
DEAD IRANIANS LOL
E
A
D

I
R
A
N
I
A
N
S

L
O
L
https://x.com/i/status/2074750668393373971
>>
>>538567389
personally I just don't care what Tucker's doing anymore because he's only covering Israel stuff, I don't like Israel but I can't really afford to be a single issue voter on it.
>>
File: martyrs2.png (258 KB, 470x293)
258 KB PNG
>>538567563
>>
File: maxresdefault (10).jpg (89 KB, 1280x720)
89 KB JPG
Why.... why did she have to leave the group....
>>
>>538567541
there are many good reasons to disavow trump

tucker actually knows trump and spoke with him often, so his disavowal carries some weight

he even just said recently that "trump hates christians"

says hes always been mad that the christians are so stubborn on gays and abortion
>>
File: AI scary spellcaster.png (1.96 MB, 1216x832)
1.96 MB PNG
>>538567563
one of the most brown things brown people do is die in explosions, desu
>>
>>538567457
that's why i'm waiting for 2027.
the automakers are going to end up having to do what walmart is now doing.
literally every publicly traded corp has been gouging.
every last one.
>>
>>538567623
im not a big fan of tuckers shit lately either
>>
>>538567703
There is a common misconception among your ilk that this is a cult of personality or that most people want to be friends with Trump personally. I don't really care about Trump's personal opinions of Christians, Whites, whatever, the result of his governance tends to be in their favor. I find Trump funny and I like how he approaches politics, I would never associate with a man like him in my personal life. This is a large part of why Trump can have a 40% approval rating and still beat the people you support, he simply governs better than they do, as much as it hurts to admit it Trump is the adult in the room in DC, hell he's back largely because his opponents shit the bed so hard.
>>
File: 1781403270805505.png (2.9 MB, 1920x1314)
2.9 MB PNG
>>538567703
>there are many good reasons to disavow trump
nope, not one
have a hole and fuck off, faggot
>>
>>538567787
Wow! Way to go, walmart!
>>
>>538567891
thanks, i was waiting for this hole to float by again
they're like trading cards now
>>
>>538567868
>im not a member of the cult, so there is no cult
bad logic

>>538567891
trump hates jesus and followers of jesus, thats one big pint
>>
>>538567980
>pint
point*
>>
>>538567980
you are just spouting obvious horse shit now.
here's your prize!
>>
File: 1781213777289558.png (828 KB, 1216x832)
828 KB PNG
>>538567980
>>538568005
you are misbehaving
>>
>>538567980
Eh, bitch and moan all you want, Trump's base has shown significantly more willingness to go against his stated desires than probably any politician in recent history, he's had to backtrack and correct course on multiple issues over it and until this year his primary endorsements were pretty hit or miss. This insistence that Trump is a cult of personality is just coping with the reality that this is just how politics are going to be from now on, there will be no great return to the political dialogue or the GOP of Mitt Romney, if anything Trump is a moderating influence as things stand now.
>>
>>538567980
>trump hates jesus and followers of jesus
no, he doesn't, you retarded faggot
>>538568050
>>538568064
love those holes
>>
>>538568050
>>538568064
trump is pro-abortion
pro-gays
pro-trans

trump doesnt repent, he doesnt ask god for forgiveness

praises allah

loves the synagogue of satan

visited the antichrist rebbe schneerson and did a jewish mystical ritual

etc

>Don Colossus: Pastors Dedicate Trump's Gold Statue at Doral — Antichrist Biblical Parallels
https://www.youtube.com/watch?v=ZflsrSobanw
>>
>>
File: 1772506193478890.jpg (59 KB, 1024x833)
59 KB JPG
>>538566280
The fact they say a 30-06 was the caliber used is enough to dismiss this entire case. Anyone who disagrees is a noguns retards. Simple as.
>>
>>538567770
https://x.com/i/status/2074831039143280820
>>
>>538568194
youre the retard if you think trump knows jesus christ
>>
>>538568336
you said you were going to behave today and yet here you are
>>
>>538568347
>faggoty bullshit
>lefty meme
YWNBAW
>>
File: 1782159724756175.png (1019 KB, 1216x832)
1019 KB PNG
>>538568336
you got a bad batch of dudeweed queerton
>>
>>538560672

Trump´s got special Honour Guard:

https://www.youtube.com/watch?v=Vhojm_VmOUI
>>
File: 148046784785469.png (464 KB, 507x711)
464 KB PNG
https://www.youtube.com/watch?v=9ixUklavc04
>>
>>538567787
I hear you. Heres hoping, right?
>>
>>538568371
everybody knows Jesus Christ you fucking imbecile, he's the most famous man in history
>>
>>538567770
das rite
>>538567868
idk why people think 40% is bad, it's not. even if you ignore everything else, ceteris paribus, it's not at all.
>>
>>538568468
matthew 7:21-23
>Not everyone who calls me their Lord will get into the kingdom of heaven. Only the ones who obey my Father in heaven will get in. On the day of judgment many will call me their Lord. They will say, “We preached in your name, and in your name we forced out demons and worked many miracles.” But I will tell them, “I will have nothing to do with you! Get out of my sight, you evil people!”
>>
File: 1681256196991533.jpg (86 KB, 1080x837)
86 KB JPG
>>538568453
having hope is maga
>>
>>538568336
>overturned Roe v Wade
>got trannies out of girl's sports
I'm pretty sure you've never even cracked a Bible but there's a verse in there about good trees giving good fruit.
>>
>>538568527
>>
>>538568562
he didnt do either of those :/
>>
where’s coomerpole?
>>
Reminder that I am baking. Worry not and be just.
>>
>>538568562
>but there's a verse in there about good trees giving good fruit.

fruits of the spirit, not physical fruits

>hurr durr, we mormans are good people, that means are fake bible is true!

no, a good tree produces good fruit of the spirit

good fruit of the spirit is obeying god
>>
>>538568594
Look man if we're debating what's going on in your fanfic alternate world then I don't see the point.
>>
>>538568663
>are
our*
>>
>>538568594
>>538568663
>>
>>538568562
>>538568594
oh yeah look at these tweets he made about them one time
>>
>>538568548
How do you get around?
>>
File: 1367698356734569.png (364 KB, 590x537)
364 KB PNG
https://x.com/RapidResponse47/status/2074863828794224715
>>
>>538568663
>fruits of the spirit not physical fruits
no shit, did you look it up in ChatGPT to get that clarification because I don't think anyone could ever read the verse and think it was about literal fruit
>>
>>538568676
trump is not on the supreme court, retard

by your logic trump just upheld birthright citizenship for illegals :/
>>
>>538568656
bake it up bakey
>>
File: lel.png (23 KB, 167x117)
23 KB PNG
>>538568676
>debating a bumpslave
>a self-professed long time bump slave
anon.
cmon now.
>>
Still baking.
>>
File: 1781395306071599.png (1.35 MB, 1216x832)
1.35 MB PNG
>>538568754
this
he deserves only holes, nothing more
>>538568743
>>
File: 172026050108444.jpg (124 KB, 646x1159)
124 KB JPG
>>538568426
>noguns city slicker hasn't an idea of what the fuck hes talking about
Many such cases.
>>
>>538568733
anon, "doing good things" is not the good fruit jesus spoke of

if that was the case than there are many atheists who are "good"

jesus was speaking about spiritual things and not physical, as he often did

you were the one trying to say trump is a christian because he did something good once or something

works do not prove spiritual faith, they only justify it
>>
>>538568754
its not much of a debate

i mopped the floor with you losers this thread :/
>>
>>538568718
i have a car.
i just want a new truck
>>
>>538560964
High gas in Commiefornia is GREAT!
Anything that makes mexicans self deport is great.
>>
File: Summer morning v3.png (1.83 MB, 1024x768)
1.83 MB PNG
>>538568840
>>538568840
>>538568840
New thread

>>538568840
>>538568840
>>538568840
Go now
>>
File: board-troons-be-like.png (514 KB, 755x960)
514 KB PNG
>>538568886
it's not a debate if i never took you seriously to begin with
>>
>>538567389
tucker is a muslim now
he's also a frequent visitor of the bohemian grove
he's also a glownigger
really don't believe any of his lies
>>
File: Explosion who did that.jpg (107 KB, 1080x673)
107 KB JPG
>>538560788
Some of the explosions in Iran are the IRGC assassinating each other.
There can only be one supreme leader.
>>
>>538568367
the jew flags spoiled it.
>>
>>538568594
>queerton pretends he doesn’t understand the argument again
That’s how you know he’s lost.



[Advertise on 4chan]

Delete Post: [File Only] Style:
[Disable Mobile View / Use Desktop Site]

[Enable Mobile View / Use Mobile Site]

All trademarks and copyrights on this page are owned by their respective parties. Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.