CBT ends September 7, 2025 11:00 PM EST>Download & key redemptionhttps://playbpsr.com/>/bpsrg/ Resources, links & guideshttps://rentry.org/bpsrg>GuildsYotsuba | 13058Never | 115389Send a message when you apply mentioning /vg/ (Click guild leaders name/icon and message)Applications are often flooded by randoms, if you can't apply, ask for a manual invite>/vg/ World Channel1488>Trailershttps://youtu.be/uu-9bIIj0jEhttps://youtu.be/Px_DtSUjs4s>MeetupsEnd of CBT Meetup | Saturday 9/6/25 | 3 PM PST | Rooftop Garden (Ocean Hill Waypoint in Asterleeds)Firework show at 4pm PSTPrevious:>>537972709
NIGGA YOUR NAME APPEARS ON THE RIGHT SIDE OF THE BUBBLE TEXT WHILE ALL OTHERS ON THE LEFT SIDE. NIGGA WHY WOULD YOU EXPOSE YOURSELF LIKE THIS. HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAAHAHAHAA LOG LEAKING SHITTER
[BPSRG MEETUP NOTICE] - LESS THAN 48 HOURS AWAY!FINAL CBT MEETUP FOR FIREWORKS SHOW>TitleRooftop Fireworks Date - bpsrg >LocationOcean Hill Waypoint- Rooftop Garden>Date and TimeSaturday, 3PM-5PM PST. Line TBD.>Bringing a datePlease bring a date for the fireworks show if possible. Solo attendees are allowed.Our resident leaker will screen record the entire meetup and shame every player who’s there alone without a date.You have 48 hours to find a date.A date is defined as one of the following: a) a person you publicly claim as your dateb) a person you are seen holding hands withc) a person you are seen in close proximity with who you move as a unit with>Q: can i have more than one date?yes. for the open relationshippers, you could go as a trio.>Q: what if I don’t have a date?No worries! The meetup is for EVERYONE. You can attend without one. However, many of us will be going with a date—and you will be shamed for being alone.Your name will be: >listed>with portrait and card photos>with personal space photo>all other identifiers>a screenshot of you standing alone will be obtained>it will be caught on tape and uploaded unlisted to YouTube as video evidence.Thank you.Remember, this is a chance to incentivize you to find some new friends and get close to anons before the beta ends.Treat it like prom. You don’t NEED to have any romance in your date. Just a partner to have a good night with. Thank you and we look forward to seeing you all on Saturday.-Yotsuba event organization team
My f2 maid is going to sleep now. Please say good night & sweet dreams
>>537994325LMAO HE ACTUALLY EXPOSED HIMSELF
REMINDERTHE BEACH FIREWORKS EVENT MEANS THAT OUR FINAL MEETUP IS GOING TO BE A DATE MEETUPIF YOU DON'T HAVE A DATE:>YOU /WILL/ BE NAMEDROPPED>YOU /WILL/ BE CREEPSHOTTED>YOU /WILL/ BE LAUGHED ATCONFESS TO YOUR CRUSH, NOW!
>>537994325kenzou why are you leaking guild chat? you know YOU yourself the name in the chat appears on the right side while all others around you are on the left side? why would you expose yourself like this.
>>537993958>i was unironically defending kenzou this whole time but he really was doing the astroturfing ITT to boost his rep
>>537994325Benchy is kenzou i called itgive me officer now
Kenzou just exposed himself as astroturfing himself what a fucking idiot lmao
Certified mid-tier f3 seeking a +1 for the meetup! We can chat about some mundane topics! Or you could afk the whole time while sitting next to me! We could even hold hands! I am dead serious.
>>537994326>>537994405>at least three anons have unironically confessed since the bullying startedBULLYING WORKSGET A WIFE, NOW!!!!!!!
>>537994325I think you guys are taking it too seriously, he probably just thought it was funny and posted
>>537994464m2 here, add me ill accept when i log on tomorrow
>>537994496>talking in third person
>>537994464Post your f3 so I know who to DM
Yes the one time I posted something I found funny I fucked myself up.
>>537994496>he probably just thought it was funnyit is a bit deranged the levels you go to defend him lmaoim so sure that’s something someone would post, someone who has proclaimed he never leaks logs or really even posts anything that isn’t screenshots of his character with othersthis guy is legitimately just astroturfing and he got caught, it happens bro it’s shameless and embarrassing but you just gotta move on
>guys it was funny not astroturfing myself, swear!
>All the posts about Kenzou samefagging were truetop fucking kek
>>537994553you were on today's menu after all
>mfw this guy is actually desperate and a samefag dude what the fuck this is hilarious
>>537994673male players are so fucking pathetic
Does anyone want to go to the fireworks show with a m2?
>>537994661Yep, sure am
>>537994717all male players should be what male characters were designed to be: invisible wallflowersif a male character goes around yapping saying let me tank for you and please reach out to me if you need someone, that is the definition of sexpest
>>537994820sexpest means someone who bothers you for sex
>>537994820real male players dont even need to talk to attract pussy. they play the game and be giga chad aura.
>>537994773>Kenzou trying to downplay the fact that he got caught astroturfing and posted his literal own screenshot log leaksbuddy didn’t post a single game screenshot for days (that wasn’t astroturfing) and this is the first one where he actually got caught oml im in tears
>>537994541I'll drop a hint, but it should be easy. H
https://poal.me/iebznthttps://poal.me/iebznthttps://poal.me/iebznt
This shit is embarrassing but at the same time it's not that big a deal. Half the namedrops in this general are from people self namedropping themselves for clout.
>gets caught>a random anon suddenly mass replies and says “he was probably just trying to be funny”>2 mins later Kenzou posts >that’s what I get for trying to post something funny for the first time>2 mins later another anon replies (insinuating they’re Jiggy) and says you’re on the menu lol we’re all in on the jokeIs he just samefagging to save face or is Jiggy helping out? Either way this is the most blatant damage control I’ve ever seen lmao. Out of nowhere 3 posts from “different people” discussing how it was just for the funnies (when there’s been far saucier logs today and those logs were not funny at all, just implied innuendo)
>>537995185it was clearly kenzou trying to pass off as the leaker or some random in the guild who got jealous the kenGOD was getting some game with jiggy (Jiggy of all people lol), boosting his reputation as some sort of lady killer. he is quite popular with some of the ladies ill admit, but this gave me second hand cringe
>>537995337>still trying to astroturf christ, you are mentally ill.
>>537995121Not interested Hamutitty. Can I get a +1 who’s not a whore involved with Toblerone please?
I told you niggas this dude was obsessed with the thread and his rep. Idk why no one believes me when all you gotta do is browse the /bnsg/ archives to see his cringe shit on full display.
>>537995185>tfw you're just funposting from work and somehow you got ropped into big conspiracyThis is exhilarating
can we get back to the main topic at hand: FINDING A FUCKING DATE FOR THE MEETUPi think we should put together a list of available anons of all genders and body types, so anons can put themselves up as available and other anons can go through the list and DM potential dates
>>537995520I just told my pet she's coming with me.
Hamutitty, Hamushitty, Hamusthrowafitty, Hamusissy, Hamufifty(years of age), Hamugrippy am i missing any other variants?
I don't need a date I just wanna get milked
>mfw I joined Never instead of Yotsuba
>>537995654refer to this list
>>537995496I don’t need to look at bnsg archives to believe you, anon.I mean shit, the guy will bake a second bread 30 minutes later if he’s unsatisfied with the first bread then spam for us to move over like we have to use his bread.I hate retards like that.
>>537995725How do people even know I'm a huge degenerate? I don't even talk in the GC or current chat
>>537995876You smell of cum
Lurker hereCan i still get into the beta and download the game or not?Still make it on time to help one of the lonely people show up not alone
>>537995956I've been eating healthy foods!
>>537995725I'm an apex degenerate!
I doubt any of the male characters have a date for the meet up. You should just ask one of them and I guarantee you 100% they will say yes to the first person asking
>>537995981not unless someone has keys they haven't used yet, very unlikely at this point
>>537995989Try washing yourself from time to time then. Dried jizz is falling from your body
>>537995431Wrong
>>537995520>>537995554this but i made it romantic because she's a sucker for that and i wanted to spoil her for doing something good recently
>>537995725I'm lewd for anons I like, but when I'm lewd I'm apex degenerate and WILL make my crush be at risk of dehydration.
>>537996028I'm male and I got a date, but I could talk my date into sharing me if it's the right anon asking.
>>537996301This is a fucking lie
>being this much of a manwhoreMale players, everyone
>>537996325You're right, she'd probably encourage me to instead of needing to be asked because she's a fucking masochist, as long as she gets the main hugs/kisses when the fireworks go off.
god i love shitposting and pretending to be a male character
my crush better ask me out on the date or else
>>537996695why aren't you asking your crush out? are you crushing on a male and expecting him to bend the knee to societal traditions? that's just going to end with you getting cucked sis
>>537996695or else what huh? you not gonna ask her out anyway? oh nyooo
>>537996749Males always have to be the ones to ask. Us girlies expect to be treated like a princess so he should stop being so dense!!!
>>537996695this >>537996749>>537996878you're going to get cucked anon, at least one male is going to get asked outmaybe it won't even be kenzou or robit's practically guaranteeddon't sit there assuming you've won when you've done absolutely nothing>>537996028I can already imagine an anon seething later todayImagine someone like scoozy or noir posting something like this>I asked a male out to the fireworks festival and he told me he already had a date...
Maybe pso2g was right about male characters after all...
>>537996947scoozy is going with pastel
People roll male specifically to avoid e-dating.
>>537996947Girl characters here are to scared to ask males out on a date since we have been brainwashed that males have to be the ones asking.
I just want to see him happy, okay?
>>537997148tough luck for them cause i want to edate a male and i will get one
>>537997213not only were the girls brainwashed that the males have to ask, they were also brainwashed that every single one isn't interested like the anon above you saidi bet most males would be willing to humor a girl and go "as a joke" if an anon asked them out and they were a bro that they played the beta with
If a type 2 female asked me to go to the fireworks I would say yes...
>>537997148I've played male for 10+ years and I like edating, I prefer cool aesthetics over slutty ones and males get that the most.It's also way easier for people to assume you're a top and not waste your time thinking you're a bottom, unless you play a certain kind of male characters.
>>537997654>It's also way easier for people to assume you're a top and not waste your time thinking you're a bottom, unless you play a certain kind of male characters.god i fucking hate that shit, it's the whole reason why i don't immediately write off males because everyone has had to deal with a pushy retard trying to make you bottom despite saying you aren't interested
I'm a male character who doesn't edate
I'm a male character who just wants to pump and dump youhttps://files.catbox.moe/2xxu8i.png
>>537998373me on the right but I'm an f1
>>537998373hint?...
I'm a female character who would do the same to you.
>>537998406boring make a f2 then we can talk
we really did get all the pso2g rejects...
You are spineless.
>Game dies in two days>Will never see my crush again because they aren't planning to come back for release. . .
>>537998868You sound like a little bitch.
>>537998935imagine never seeing the person you love again
>>537998781They will go back to their containment general in two days. These discord tranny tourists cannot live without drama after all.
>>537999010Then add them on discord or any other platform? Fucking retard.
>>537999114They don't use discord
(You) will be my date to the meetup.jk I'll be having all the fun in the world alone in a corner and you can't do anything about it
>>537999149Do you want to go with my m2?
>>537998781None of the popular ones joined yotsuba for whatever reason. They did play althoughbeit
>>537998450Its a shitpost sis. All our lewd males are asleep or in bed relaxing.
>>537999278>none of the popular ones joined yotsubaYou were saying?
>>537999361>you were saying>only popular anons in screenshot are sipsoo and wakaba neither one joined yotsuba what's your point?
>>537999256Depends...
>>537999616my friend who caves way to fast...
>>537999605>wakaba >popularLMAO
>>537999605Sips was never popular, she just had one or two obsessed schizos
>>537999759that's me! both of them!
Uuuuh my dancho, so fragrant...
>>537999278whos popular anyway, Only K, R and S comes to mind, and out of these 3 only K got into the beta afaik
>>537999616you're in the wrong guild.
>>537999616Depends on what?
>>537997213could have been me and karina...
>>537999929None of them were popular when it mattered.
>>537999605wakaba is the original clique fag. he played with his cumrags.
>>538000026Yotsuba is/was full>>538000072Post your m2
Thanks for all the tier lists last thread. It gave me a moderate ego boost which will surely be crushed in the next 5 - 15 hours.
>>537997213potential yotsuba for this feel?
>>538000707gonna crash your lovense
>>538000960Can that happen? I've never had that happen..
>>537999278>None of the popular ones joined yotsuba for whatever reasonwhy would anyone join yotsuba LMAO y'all a bunch of schizo snakes
Remember to ask your crush on a date for the meet up! Only one day left!
>>538002245Four anons have asked out four crushes. Keep pumping those numbers up bros.
>>538002567I hope my male character crush asks me out...
They said no. I want to die
>>538002245but i'm going to be busy gooning...
>>538003045>Not gooning with your crushngmi
>>538003358>Not gooning with every anons crushngmi
>>538003358i have like... 40 doujins saved that i want to look at so i'm going to do that... alone! :3
>>538002640I am going to ask out every male. You are getting cucked sis.
>>538003446>Not streaming it over discord so you can goon with your crushngmi
>>538003478Lies... You are just saying this to make me feel bad.
||I don't like the hornyposters anymore because I realized that some of you maggots are keylets.||
>>538002904Wish it was me..
>>538003485good idea! i'll keep it in mind if i ever make a friend like that
>>538003612>he can't spoiler how new
>>538003612||This a lot of them don’t seem to capable of putting together full sentences in an ERO situation. And also seem fucking desperate often.||
>>538003746hey...https://litter.catbox.moe/dpcjczve9alrdw06.jpg
>>538003612cute..
>>538003758||>he can read ERP detection text||Hey...>>538003850Hi Hi ||Hi||
>>538003612>>538003826||What the fuck is a sentence?||
||is this the new meme now? Pretending this is functional spoiler text? You guys are so irony poisoned it's like a circus here.||
I don't know how you fuckers can write whole novel while ERPing and doing it for real. At some point I get horny enough that writing more than 2 sentences is a struggle.
>>538004036||Honking your nose and running away||
>>538003848hi! https://litter.catbox.moe/22k4r443512olluu.png
>>538004101I just usually text fuck with whatever GAM is on the other end of the ocean. Written ERP can be fun but most people just wanna get off, so doing some short, sweet stuff is ideal.
>>538004101||honestly most people don't mind waiting for slow typers as long as you aren't the type of fag who takes 10 minutes to say 8 words||
>>538004114wanna? https://litter.catbox.moe/8dnbl73gdmy35o7g.jpg
>>538004228Meet at line 9 on the dock
>>538004228i wasn't planning on being a horny lewdie just yet, sorry! still have things to do in the morning first :3
>>538004114TEXANS, DO NOT OPEN!
>>538004359Can I watch...
>>538004359You must post something lewd first so I know you are serious>>538004367Maybe next time then :3https://litter.catbox.moe/o34de1jp4qwujkrp.jpg
>>538004468Meet me or don't, you sound like that keylet bugging people for lewds.I am leaving with whoever shows up first
>>538004384woe, witness loli upon ye!>>538004468we have to do it next time for sure without failure...https://litter.catbox.moe/hly0uu65ux8snbvb.png
i'm jerking off desu
>>538004773Why would you do that…
>>538004671Next time indeed can't wait, i'll have to use my time nowhttps://litter.catbox.moe/m1swh9bbf76ew2wd.jpg
>>538004785good luck pumping it, stroking it and blowing a load :3
>>538004949I'll edge and build up a good load in your stead.https://litter.catbox.moe/6f736w2amzpkkr4z.jpg
>>538004667I didn't realize you were a degenerate... glad we could add each other
>>538005065me as the ona
>>538005065ganbare!~ ganbatte!~ mwah!~ mwah!~ one, two, three, four, pump out a sticky load!~ https://litter.catbox.moe/4n8bsw0y4a7ipryc.jpg
what no pussy does to a mothafucka
I saw the 2 that met up..
>>538005421I’m busy getting treated like one. We’re not the same.
I cheat on my boyfriend so he grows as a character...
>>538005514post them
||Meetups > thread discord burners||
>>538005647i goon on my main discord
>>538005609I don’t remember making this post…
>>538005514Meet me at weaver shop and spread the deets?
>>538005514Inb4 anon namedrops people who aren't even online
>>538005710Holy BASED
>>538005609This but my girlfriend. And she watches!
>>538005609>>538005727>>538005889hot... i wish i had a gf that would cuck me...
>>538005889I need a cuckquean gf...
||I fucking hate some of you gooners.||
>>538006008I’d build you up only to shatter your heart. Don’t wish for something you’ll regret anon
>>538006049hiii~
I found someone I want to groom into being a sextoy for my bf..
>>538006165hey do you wanna watch me plap other girls?
>>538006168Hint?
>>538006168Who is it…
>>538006234yes please...
>>538006168Me too but I do not think she would want that, I think she wants to get a personal bf.
>>538006374Give me a name so I can DM...
>>538006241>>538006306A submissive little f1 of course..
>NA hours>Drama everywhere>EU hours>ERP everywhere
>>538006490Do you have any idea how little that narrows it down!
>>538006567That's the point! I'm not sharing her with your harlots
>>538006618Is it meeee?
>>538006410well... it's a bit embarrassing to put myself out there in that way, you know... but if you see me running around or at that one meetup coming up, at least you'll be aware of who it is :3
>>538006743Yes!
>>538006778nevermind you are kind of ugly
>>538007163phew, thank goodness...
>>538006990Yay :3
>>538006778mommy...
rip...
>>538006778biofem coded character
>>538006778cool character
I want to spend every waking moment of my entire life balls deep inside of effy
>>537994326>Bring a date... This is very complicated~(◕︿◕) I do not believe I qualify for the event.
>>538007464>>538008337>>538008396t...t...t...t...thanks...
>>538009023It would be the other way around
>>538009023That's not at all the mood lately
Why are people stressing out over a date? Just pick up a t1. They're literally free. No one is going to stop you
I can't even make it to the meetup because of timezones, this sucks
>>537994326Why are you weirdos always trying to turn /vg/ into a highschool dating scene
>>538011237trying to experience even a fraction of shit they've missed out when growing up
Do you all miss me?I miss you all....please come back...
>>538010540it really feels like everyone in the general only gives a shit about loli cunny t1 females unless the t2/t3 is a known popular namefag from another mmo general
My male character gets namedropped often, yet he will be going alone to the fireworks meetup. I have a girlfriend and even if things aren't going well I will remain loyal
>>538013967I'll change that
meeting in game is boring let's go straight to discord
>>538014537Hmmm no
>>538014537basic ass /trash/ nigga sybau
>>538012748Nonnys are down bad for little girls~
Why did scoozy change color
>>538015708Diversity hire
>>537994326>Date and Time Saturday, 3PM-5PM PSTLiterally the time i go to work, kek. Have fun for me sisters
>>538015708Because hes a dude and he doesnt care about you bro
>>538016801No...
>>538016876Are you trying to groom spooky to be girly or some shit lil nigga?
now that we are nearing the end of the playtest, share what you liked/didnt like with an invitelet, I only trust anons for game opinions.
My blue protocol is the zapp brannigan of bpsrg
Best swimsuit? Best maid outfit? Best weeb outfit?For an f2...
>last meetups are date meetupsI will simply not go
>>538020754I will wallflower like I have always done
>>538020754It's not an actual date meetup, that's just thread being thread.It's a regular meetup where we all go and just relax on the last day, nothing more.
>>538020867who the fuck is we? I’m going with a date and I know a handful of others who willNothing wrong with going alone ofc, but nothing wrong with having a date
if you don’t bring a date you’re a loserdates can be friends, just go with a +1going alone means you’re a wallflower outcast
>>538021029I'm not saying you can't go with a date, I'm just saying it's a regular meetup and a date is not needed or even mentioned in the original post.
>>537978538>put in footjob tiergood job on paying attention to the fact that the only shoes I wore this beta was when I got the commanders outfit
>go on a date with another dudeor>get called a loser by the ERP squadchoose wisely anon
>>538021419Just ask Scoozy out.
>>538015708to what
>>538009060you can't show me blanc and then not have your character look like blanc
>>5380214193rd optiondont go to the meeting and just chill with randoms elsewhere
>>OMG GUYS LOOK AT THIS EMBAAARRRRASSSING THING SOMEONE SAID TO MUCH GOD I HAVE TO DEAL WITH THIS ALLLLLLLLLL DAY
>>538021503Scoozy can't be a man! She can't be!
>>538014537good opinion>>538018624i've only done the story and not much else at all so keep that in mind but i think the foundations of the game are good, it just needs to be polished and improved upon a lot more. there's a lot of untranslated stuff (like when i did the patrol leisure thing, the text was entirely in chinese in that reward box that pops up on the left side of the screen) as well as mistranslations that make it all feel extremely janky, the ui also isn't the best either but i can see why it is the way it is, i don't like the battle imagine naming it sounds unnatural but i don't know what name they could've gone for instead... just a lot of janky stuff translation wise i guess? will have to see about the dressup portion of the game, i don't like how hairstyles and outfits are locked behind opening up my wallet...>>538021751i'm not good at the character creator in this game honestly, sorry!
>>538022079Got some bad news bro
whys dating and e-relationships always the endgame for mmo generals?
>>538022232i dont understand eitheris a damn game not a dating app
>>538018624i've liked the gameplay so far with ice mage, the life skill system needs an overhaul and the overuse of menus when they take up your whole screen is obnoxious
>>538022232i was horny but now I'm bored and regret starting one
why can't I find this expression in game? it's not the teasing face
>>538022526
>>538018624There's too little unbound luno and buns rose orb generation. Especially for how the high minimum prices are for things.Dyeing is extremely ass. I highly recommend making your character have a defined color palette and sticking to it.There needs to be a few more good outfits available for f2p.Imagine crafting IS going to kick some people's asses with how jewy it gets
>>538009023Same but the other way around
>>538022526In the JP version it would come with that emote, but some of the emotes don't use their expressions in SR, even though they do in the character creator, game is jank.
>>538022526Female kenzinger
>>538022526close enough, i will now reer to you as little sister, even if we will never meet.
how do i get my dyes
>>538023619Honestly the best route is grabbing the packs when they show up in the mystery shop
>>538023619*morefuck>>538023721shit
>>538023779It's hard out here in these streets. You can craft them at 25 stamina a piece, but remember that you need 12 PER channel you're changing. So it's easily going to 48+ dyes for an outfit, or three whole days worth of stamina. Buying them from players is also gonna be like 140k for all that. It's so ass.
>>538024009>Turning even gayerNice
>>538024104>>538023779>>538023721>>538023619nta but fuck this stupid dye shit i'm going to make a pale black haired goth so i don't need to deal with it
>>538022232My end game is mating with (You).
>>538024227You still need dyes for making shit black or white, sadly. But that'd say least be a strat to not feel compulsion to change often. Genuinely, I recommend picking a color scheme and sticking to it.
>>538024380but im a boy
>>538023148Same but I want to spend every waking moment of my entire life balls deep inside of effy while effy spends every waking moment of his entire life balls deep inside of anon
>>538024465Just pretend you're a girl for 1-2 hours okay?
>>538022232MMO generals have enough love triangles, schizos, and cucking to be an Aquarion season.
>>538024009Getting ready for transition?
>>538024161>>538024729*turns into a car*
I can't believe how the average player in this game is either a teen or a groomer
>>538009023>>538024517hope you like watching effy shove her futa cock in mofu's blown out pussy
>>538025135That's literally every online game these days
>>538025158Hey, I haven't plapped here yet! >:(
>>538025158>tfw love effy>tfw hate mofu
>>538024517This is agreeable
>>538025281literally me
>>538025135age restrictions can't come soon enough.
>>538025324they will have a fight sooner or later
>>538025345LONDON?
>>538025158>cringe topdropped
>>538025504and then have mentally ill makeup sex..
>>538025594kill yourself
>>538024898*Drives you for an hour*Get used bitch
>>538025720He took me near the watermelon. What do you think this means?>>538025729Thanks for filling me up with fuel..
>>538025869when are you two going back to xivg
>>538025973Will you also go back to the game you played before this?
>>538025973When the CBT is over & then back again when it launches
>>538025869It wasn't fuel it was my cock, haha, idiot
>>538026089when are you two quitting this game for good tho
>>538026214>anon will soon understand that people can play multiple games
>>538026214If I stop having fun. I only play XIV to take screenshots & to run deep dungeons, occasionally raid if I coerce someone into joining me
>>538026159Aha that would be terrible if you did it same time tomorrow, like..so bad..
What's the fastest way to get 1.2k soulbound orbs?
>>538026374Sure faggot
>>538026569thanks, love you..
>>538026413buy them from whales with 600k unbound lunos
>>538026413
good morning
>>538026604Uh cute faggot!
Should I buy a vr headset?
>>538027784No
so is Mastery actually kinda bad on Shield Knight despite being a recommended stat?i ran the moonrunes through yandex and if i'm understanding the rough translation correctly, all it does is boost how much shield you generate or what percentage of damage the shield is allowed to absorb on hit...it sounds really bad and counterproductive
>>538027784do you want to give up on life, regularly go to irl meetups with other fat ugly hairy neckbeards and trannies in florida and netherlands, do drugs (fent and hrt usually) and have imaginary vr sex all the time filled with drama? sure join vrchat and /vrg/ on vg and trash
>>538027843a % inside a % is always bad
>>538027927Is it really just going to be ugly people and druggies?
>>538028353you're not going to get cute looking twitter onlyfans femboys or women with 100k followers showing up to those vrchat fuckmeets irl
>>538028435anyone with a modicoom of good looks, heck, average look will try to avoid creeps
>tfw in good shape and handsome>also autistic and nervous 99% of the time
>>537994325>Have a funny chat interaction>Share it>Immediately blasted for "leaking logs"This wouldn't happen to anyone but Kenzou
Nap time..
Games dead, jim
>>538006080>Discord spoilersSelf deprecation isn't funny
>>538029890The crown is heavy, ese
Any news as to what patch we're launching with?
>>538025281>>538025324>he’s not hate fucking one whilst smoochmaxing the other ngmi
Should I ask Scoozy out on a date for the last day of CBT?
>>538030897Sure, why not
>>538030897ask the magic 8 ball
>>538030897What’s the worse that can happen? He says no and walks off with Ken?
>>538031043It's over. I will now move on forever.
Serious question is sex with femboys even any good?
Should I ask Rob out?
who will be my date? >_<
>>538031318Males should be making the move.
>>538031301yes!
>>538031301If you don’t mind the occasional mental breakdown then yeah, it’s the best
>>538029931Where do you get that hat?
>>538031318My queen, you deserve only the best so you should go for Male T2 or T3.
>>538031301That depends. Hung tops or small dick bottoms?
>>538031527this months monthly pass gives it
>>538031301I had sex with a racist white femboy and it was pretty okay.
>>538031621Time to buy the monthly pass on release..
i'm hiding that femboy post
>>538031781Best kind
>>538032297post your bussy now
>>538031602Hung bottoms. Wanna see it flop around uselessly
i hid that post too
maybe stop larping as a nazi while wearing cat ears and you wont attract thugs
>>538032580How do I attract a gameplay wife?
>>538032771You don't.
>>538032580I want a little faggot like this tho
>>538032771you dont, she will be to busy grinding the game to socialize.hey...
>>538032771invite gameplay maidens to party. Talk about other games. Have a sense of humor/wit. You gotta win via the mere exposure effect with those types.
>>538032934Fag.
bpsrg hood takeover?
>>537999817Danchou feet!
Thoughts?
>>538033450Time to make a min height f2
>>538033450I want a male minheight boyfriend!
>>538033450m2 or m3 for my f2
Friendly reminder not to shoot the messenger: Seio is only the paperboy, treat him kindly
>>538033450>-10tiny head ass niggas
>>538031301no matter how much they clean before fucking, there will always be a hint of smell
i lost my sprout...
>>538033984but you bloomed with beautiful petals...
>>538034602y-you too
>>538033450it's not lined up correctly..
>>538031301If you have a proper bottom femboy that can into prep yes.
Angry bread eating
>>538033810Only if you're a -10 f2
>>538034772I'm a -7...
>>538033450I'm going to make a type 3 male relieve all type 1 females from their sexual tension
>>538035015>he doesn't know
>>538035015Nobody is interested in males, and if they are, then its 1 and 2
>>538035756Alright, then I'll make a type 3 female relieve all type 1 females from their sexual tension
>>538035869Maxheight m2 for my minheight f2
>8 hours later at 400 postswhy did this general die in 2 weeks
Dont feel like logging in after being ranked as extremely annoying and ugly last night... enjoy the rest of the cbt guys
>>538033450>>538034717fix'd
But I’m a maxheight f2…
>>538036062It's the last two days of the beta, people dont feel like playing when its getting wiped in an instant.
>>538036145auti...
>>538036145:c
Don't hole up in guild center, go outside!
>>538036247and just for fun
>>538036145auti doesn't type sloppily like that imposter
Definitely going shield knight on launch.Heavy guardian kind of blows desu. Not only does it fall behind but also because the sword magnet spike looking thing looks so fucking dumb and clashes with fashion, sword and board looks way aesthetically more pleasing for any outfit.
>>538036687Add that to the list of disparagements... I'm not autistic...
>>538036731I was going to go WK and SK as my alt for helping anons
Date?
>>538037075nah ur cring
>>538033819he's also an enormous schizo from xivg
>>538037101
>>538037157just like the rest of all your boogeymen right?
>>538037157Hate seeing someone get exposed for something WE ALL do
>>538034956That can be ok
>>538037157>hespill the tea my knower nigga
>>538037574has no style
>>538037574he has no grace
>>538037574this yotsuba has a funny face
>>538037574he's a gay pedophile that pretends to be a fujo
>>538038106that's not tea that's a description of 90% of the guildwho is it
>>538037574he only eats fries and hes related to michael kumo
>>538033450>>538033867>>538034717>>538036247i believe -5 should have the best head/body ratio
Yotsuba's t2 and t3 females. Rate em, claim em
>>538038486CATCATCATCATCATCATCATCATCATCATCATCATCATCATCATCAT
>>538033450>minheight f2s are more mature looking maxheight f1scute... if only character deletion wasn't timelocked, i could play around with this
>>538038486Sex with Pygo while she makes fun of my penis
>>538038486It was nice of Newt to leave the guild and not spoil the curve for everybody else.
>>538038486They all use the more squinty eyes
>>538038486>Cat>Hamu>Effy>oat>Cylfina>Felyall peak
>>538038486Butts!
Do nyot pick me...
>>538038486I get the feeling Cat would ride the wildest dick but also be so many red flags.
t3 females be like -_-
>>538038106next you're gonna say miyu isn't a big black dude lol..
Seia has always been my favorite Blue Archive character. But I decided to use the name of a different one instead.
>>538039193do we need to do this every day lmao you insecure whitebois in this thread wont be happy unless everyone is pastey with a barely average cockblack men existwomen exist4chan isnt your yacht club
I hate my stupid fucking whore wife so much.
>>538039504Same I hate Pygo too
>>538038486Dibs on the short ones
I love my stupid whore wife so much.
I wish I had a wife that hated me for being a whore
i love my fat wife so much
Im gonna fuck that little gremlin so hard she gets hiccups
is it me
>>538039792Tok, Bossu, Lico, Miyu, Cocona, or Jiggy.
>>538038486For me, it's Yuuna
>>538040198Stop bragging about your loose hole
>>538038486Butts is the best.
>>538039176-_-
>>538040821this is a good -_-er
>>538039176There's a serious case of sameface
>>538040875with the hard r?!
nobody likes my f2...
I have a mediocre f2 but I’m really slutty and that makes up the difference
>>538041118>>538041289i like your characters
Hey hey~ namedrop me again~ I'm bored
>>538042226No nigga go jerk off or something.
i'm gameplaying...
/bpsrg/ males:>don’t have a date for Saturday’s fireworks showrob - Male 3. seio - Male 2. dude - Male 3.anta - Male 1.Maku - Male 3.reon - Male 3. silolliallik - Male 3.axemented - Male 3.Male nym - Male 3.oni - Male 1.funkyfrank - Male 3.darius - Male 3.jean - Male 1.senny - Male 2.ginga - Male 1.>have a date Kenzoucreep Grung Cappu Kikin Isa Katomake sure to ask out your date before they all get taken!!You don’t want to show up to the meetup alone and in a corner, do you?
>>538038486Even including Blint shows how bad this general is.
>>538042531there's nobody named blint there
>>538038486>scoozy’s face kinda falls flat outside of screenshotswhat the fuck lolis she really carried by the meowlix vault hairstyle that costs 1mil lunoCat unironically looks 10/10
>>538042518you will not catch me attending with a male date lol i ain’t gay
>>538042489nevermind...
>>538042698Idk I think it looks more youthful compared to the -_-
-_-
>>538042518rob - Male 3.>boring personality extremely boring designseio - Male 2.>would, but probably takendude - Male 3.>would, but generic anta - Male 1.>would, very cute green eyesMaku - Male 3.>uglyreon - Male 3.>would, but wallflowersilolliallik - Male 3.>extremely uglyaxemented - Male 3.>has a wife Male nym - Male 3.>would but who?oni - Male 1.>would, cutiefunkyfrank - Male 3.>loldarius - Male 3.>loljean - Male 1.>would, cute!senny - Male 2.>would, but who?ginga - Male 1.>ugly admiral cap and sex pest behavior
>>538042518Why am I always the first one to be thrown into the "has a date" category?I don't
I don't do e-dating, sorry ladyboys.
>>538043532>Kenzou trying to act stupid like he doesn’t have screenshots with 12 girls you kabedon’d izuna bro
POST LOGS POST LOGS POST LOGS
>>538042518>Isa has a dateI'm killing myself.
>>538043532Oh were the Kenologists right? The mating ritual with Mr. Nigger marked the end of the 4-6 week long relationship.
>>538042518there is unironically only 2 males in that first list i wouldn’t mind being seen next to in public the rest are horribly ugly in appearance or personality or are wallflowers
>>538043617But I like taking pictures with others, it's a lot of fun and this game had a great camera systemIt's way crazier to me that you guys would even consider I'm dating someone over taking pictures
post the parse
>>538043648Don't post logs, I got loading screens!
>>538043872>horribly ugly in appearance or personality or are wallflowersI'm 3 of these
>>538043915you don’t have to date someone to bring a date brojust ask one of the hoes in your back pocket to be a +1 and have a good timeim going with a purely platonic friend but we’ll hold hands and pretend like we’re dating
POST THE PARSE
Shut the fuck up Kyoppi no one was parsing
>males can't even get a date>futas have entire haremsgrim
>kenzou of all people don’t have a date for the meetupthat’s… that’s depressing
>>538042518I don't have a date tho...I might not even be able to attend sadly.
I don't have a dateI will go aloneI will wallflowerI will be made fun of
>>538044063> im going with a purely platonic friend but we’ll hold hands and pretend like we’re dating>”just playing” I say after sharing a tender kiss in the moonlight>”pranked” I whisper as his hands slide up my skirt and wrap around my cock>”sike” I laugh as I pull out after the creampie, still connected by ropes of swinging jizz
Kenzou in my eyes is as dateable as they come, I just wish I had a legacypussy for him to make use of, I could never be the woman he deserves. Please guys, don't let Kenzou go alone....
>>538044063The whole date thing was added by others, I have no issue with it but the main point is for people to gather and take pictures together, the reason why I choose Saturday instead of Sunday is to allow others to make their own plans for the last day, be it with friends or a significant otherI don't know if I'll bring a date or not, I just want people to have a good time and the fact that they announced the fireworks for 1 hour after the meetup starts its such great timing as well
>>538044406the first part is true proofs for the 2nd part?
>>538044750the date is entirely optional but considering you will be caught on camera and forced to name change to escape the shame if you’re there alone, and everyone else is in pairs; it’s time to find someonethis is a good incentive to get anons to reach out and socialize and make friends before CBT ends too
If I wasn't taken already, I'd have a ridiculous crush on creep
I will also be attending alone. There is no love for my min height t2
>>538045113>im so alone nobody wants me>never posts igns-sugoi
>>538045113if you care about attentionmaxing then you have to play a minheight f1 and paypig $100 for the hairstyles and outfits even though you lose $50 of that money spent
The most important thing is to ask someone. Hypocritically, I will not be doing so, but that is because I don't know whether or not anyone has begun to hate me.
>>538045404Go with me Lico
>>538045470Lico already has a date LMAO
>>538045470I am not Lico. I also believe Lico has a date.
>>538045017There's also a lot that don't want to go through that too, that's kind of what makes me want to go solo, if the organizer doesn't get a date and goes alone that makes him a loser according to the thread narrativeBut if I still have a good time, it should matter, every anon that wants to attend should, regardless of dates
>>538045047no you wouldn't
>>538045518No she doesn't
why do 9 of 10 people in /vg/ generals that i make friends with always end up the type of person that gets bored of me after a week of lovebombing me and then they never talk to me again
>>538045404yes we hate you now auti
>>538045652creep...
>>538045695But we love Auti here
Why not just go alone and have fun anyways?
>>538045650i want to take photos of you and izuna on the balcony against a backdrop of starry sky and fireworks though
>>538045682because you are boring and they found someone better
I know who Auti actually is so I don't like them
>>538045682because you go for the obvious sluts
>>538045274Sometimes it's better to stay mysterious and unidentifiable
>>538045017This anon smells of mental illness
>Maku already in the acceptance phaseI’m sorry bro.
the meetup is going to suck btw because it's too out in the open, there will be a massive amount of normies that flock in
>>538045883I need to know who you are NOW
>>538044873its in the pso2g discord
>>537994254Which channel is this meetup in?
>>538046020Just like have fun.
>>538043532How long did you e-date chooby
>>538045883This is one of>Fely>Scoozy>Azyrea >Cylfinaif you’re azyrea dm me right now
come dance
>>538046093Nope. I will remain a secret.
>>538046252no sorry i'm gooning in vc
>>538046432shut the fuck up Mofu
>>538046294Yeah but I want to be your friend, who has a cock.
>>538046252Coconut was hotter with the black bikini
>>538046474don't know who that is
>>538046495Many people here have cocks
coconut lowkey one of the most generic female type 1s i done ever seensomeone post the full collage
where are the black anons?
>Anons talking about having dates with other playersI WILL download the game on my phoneI WILL play simultaneously with my cute t3 F on pc and my handsome t2 M on mobileI WILL make them a couple and have them pose and take pics togetherAnd (you) will not stop me
>>538046731miyu is still picking bananas
You can tell Coconut is not a biofem because her MMO characters are ugly
>>538046886I will befriend miyu. I want to talk to other hard hittin niggas
Does Miyu have a date for Saturday? Can someone confirm.
>>538046975are they hard pipe hittin' niggas? :3
>>538043369So true, I hope people leave me alone and don't ask for a date. I don't want to reject anyone but I also don't want to go out with anyone, I'll enjoy the fireworks by myself. also I'm a type 2, not 3
>>538046681Ye, but mines big
>>538046975i can log on if you want me to.. i was just playing trails in the sky
it’s looking more and more like we’ll have unironic single anons at the firework date
>>538046886DAAAAAAAAAAY OHDAAAAAAAAAAAAAAAAAY OHDAYLIGHT COMES AND ME WANGO HOME~
>>538042518i don't have a date
>>538047394creep?
>>538047114How big?
You guys are trying really hard to force this couples shit
>>538047146I'm at work. I'll bug you if I see you online later in like 2-3 hours.
>>538048121Yeah
>>538048121They do it in every /vg/ MMO thread, it's kinda creepy
>>538046131not in it just leak it or sybau
>>538047617i won't say cause i'm embarrassed.
>>538047040only the meanest niggas on the O'block
>>538046252>Mute game music>Play CHIC - Everybody Dance.mp3Yep, it's dancin' time
YOU DONT have to go with a dateBut you can and it is ENCOURAGED given the romantic nature of the event
me? i'm gonna find a date at the event
im going alone and sitting in the corner by myself
I don't think I'll have enough time to unlock the armband outfit in the beta.At least I got it to blue.
C rank f3 here, who wants to go with me tomorrow??
I'll just stand alone and hope someone approaches my min height t2. Maybe I'll even do a few dance moves.
this is literally /xivg/ and /pso2g/ in every essence but with a worse game that has worse graphics and no modding like either ffxiv or pso2ngs
What dance number is this
>>538048939>no moddingThe main reason I like it
Lets fix this once and for allRoll your date for the meetup
>>538048939with the addition of general/clique wars so it's even worse
>>538049003thug shaker 5
>>538049075>with the addition of general/clique wars so it's even worsedo MMOs always start with clique wars like this?
>>537990163Remember.Most anons already added their roommate on discord. Most are already asking them to date.Don’t. Let. This. CBT. Period. Be. A. Wastethis is an UNPARALLELED time of exclusivity and intimacy with a small pool of active players when the game launches YOU WILL BE COMPETING WITH 4 GUILDS OF PEOPLE AND THE COZY YOTSUBA GUILD YOU ONCE KNEW WILL CEASE TO EXISTYOUR CRUSH MAY NOT EVEN RETURNDO NOT LET THIS OPPORTUNITY GO TO WASTE.GET. A. DATE.
>>538048872we can stand next to each other whilst being alone
>>538048894my wife scoozy
>>538049134No anon is an island. They all come with prior history based on earlier MMOs.
>>538049070gross
>>538049070how do i get it to pause
>>538049134it's literally just one person from a particular general shitposting
>>538049143I dont really care its just a game lol
>>538049294use snip and sketch or hit print screen
Reminder that if you show up to meetup without a date and you're not in top 10 parses then you're a failure
>>538049143Okay lilpup you can stop trying to force this now.
>>538049250We can do it doggy-style so you don't have to see my face
>>538049163That sounds perfect! How will I know who you are though...
>>538049143stfu lico
>>538049314and who might your boogeyman be?
>>538049483i don't want to see your child body
>>538049572___(you)___
>>538049590You will be a lolicon by the end of the night~
>>538049483post butt
>>538049494my character looks like this: >>538040821
damn anon rolled super slut and is complaining
>>538048074Bigger than 7.5
>>538049851how fat are you?
>>538022232Lots of lonely men play mmorpgs and lots of biological women enjoy the social aspects of mmorpgs so the lonely men who play mmorpgs seek the biological women who also play mmorpgs.
does Noir have a date
>>538049392>t.datelet
How do I unlock the emblem so I can start upgrading it?
>>538049483where are her breasts?
>>538049817you wish
>>538049820rerolling is for dishonest faggots
Don't reroll me aiiieeeee
>>538049134When this board was new no, but at this point every mmo general is 80-90% the same people that all already know eachother.
>>538050120Boys don't have breasts
>>538050057I think you just go kill mobs with a shadow orb on top.
>>538044406>>538048241he was not lying... male bros...
>>538050207that's literally my character ingame though, the zilu picture is just there because i think she's cute...
>>538050474god i wish i could dress like this
>>538049070I'll have the NBA Y2K and the fried chicken ready.
Why do you guys talk SO much about romance/dating. STOP IT! I don't wanna THINK about this kinda stuff it makes me all retarded and sad.
I'm one of the biggest shitposter/schizo across multiple generals and people haven't caught on to who I am.
>>538050448Oh it just auto upgrades?
>>538050616It's fun
It's purple.
>>538050592just do it
>>538050450sisters why didn't the popular gals join yotsuba... are we that undesirable???
>>538050658noAfter you get the loot from them you need to go into the season interface and upgrade your things.
>>538049070>>538050597Me too, better get my jays polished
>>538049070>2 replieswhy aren’t you anons rolling i see you dancing like whores in guild hallROLL and you cannot reroll or not post your results
>>538049817Ok! I'll be on the lookout for you then.
>>538050671...Understandable I guess.
big puffer!
I need to come up with a different name for launch
>>538050828the name begins with a v if it helps, i look forward to wallflowering!
>>538050958you’re a forgettable background character in this season
>>538050450>all midsafe
reposting on request, still a work in progress, I wanna re-organize the skill tree path mainly>>538050758there's no fashion like that in game...
>>538049070>Don't even know who this is and have never talked to them.It's over for me...
>>538051082ahh ingame, i meant irl
>>538049070hmm
>>538051452I would irl but I live in florida and it's much too hot for that...
>>538051082Is 67 the max points we can expect to get?
>>538051452How about you dress up like that irl?
>>538051393That’s Risa
>>538050450the popular girls clique was real? I thought you pso2g posters were making it up
>>538051615ahhh, maybe a portable fan would help a bit... try in winter, if it gets a bit colder!>>538051682i already do from time to time
>>538050450but wakaba irl is like some 5'6 SEA monkey (fat)
He's here... I'm so wet suddenly... I'm getting cramps... I'm ready
>>538051741bro you are forcing this too hard
>>538050450who in this image does not have a date and wouldn’t mind going to the fireworks with a m2?
>>538049070
>>538051858is it me
>>538051639no that's just the core tree path I personally think should be prioritized>>538051841maybe maybe...
>>538051901They are all dating the purple one sorry anon
>>538052043Red*
How do I adjust autoplay to only use certain skills?
>>538052002i believe in you!>>538052257jirai kei rarely like mentioned and when i feel like it but usually a blend of either minimal styled elegance or cute dark black goth because i love wearing boots
>>538052369go to the options and click auto battle settings
https://www.youtube.com/watch?v=MxekyGtqcNEThis general kinda fruity not gonna lie desu
95% men.
>>538052591I'm the 5%!
>>538052528>This general kinda fruity not gonna lie desu
>>538051858I'm logging off.
scoozy needs to log in and dance next to me right now
>>538052465Gothic clothes too huh? But now that I think about it, aren't you a boy...? You might be sending out mixed signals...
Isa needs to come back to the guild center and dance next to me right now.
>>538052938I'm glad you got the joke, anon. Good boy.
>>538052985>>538053206I'm shipping it
>>538049891500 lbs
>>538053130if having a penis makes me a boy then yeah...
>>538049070I think I'll just skip the meetup....
Only biofems should be allowed to wear goth and jirai kei fashion
>>538046180thank you for the goat image, but in the end I was still made fun of for stepping out of my pictomancer circle.
>>538053459you have horrible rng
>>538046474Sorry, I don’t post cute girls.I will just shamelessly avatarfag or straight up say it’s me.That and I just woke up..
HelloPlease stop namedropping me onegai desuThank you desu
>>538053424A boy wearing cute clothes, thats pretty taboo but now I kinda want to hear more about why you dress so girly. Could post my tag if you wanted to share some more...
>>538053918okay which one are you
Isa and Kenzou dancing next to me spraying their musk everywhere... my ovaries won't be able to take it... It feels like I pissed myself...
HelloPlease keep namedropping me onegai desuThank you desu
>>538054091i don't remember making this post
>>538050450Missing one cumrag
>>538054091whys a boy talking about his ovaries
Why are boys wearing girls clothes?
>>538054002it's not that taboo, is it... cute fashion is universal and should be allowed for anyone!~ could always talk at that meetup happening otherwise, if nothing else :3
Is it okay to date a spirit?
>>538054405Aren't you the redhead who was living with a dude and making hearts with him? Did he die/quit?
Pls next thread I have some pics to post.
>>538054304>>538050450This one is missing still
>>538054775We are not going to get to 750 any time soon. Post them.
>>538054775You can just post them now
>>538053825damn you’re a neet boyfailure too?
>>538054775just post them
wtf is a boyfailure
>>538054587We're doing alright
my male character is a boysuccess
>>538054373I'll be sure to be on the lookout for you then anon!
>>538054868Not really a neet since I still have to go out sometimes. I just nap a lot..Sleep is fragmented so instead of getting a full 8 hours I’ll just nap like 4 times a day like a retard.
Anyone wanna go with me?
>>538055127Based.
>>538055131i look forward to it :3
>>538050450AZRICE DON'T LOOK
>>538055168post that kpop demon hunters video and ill consider it
>>538055051Lets have sex. Your boyfriend can watch.
>>538055127shut the fuck up miki
>>538055305This one?
>>537994326>>Date and Time>Saturday, 3PM-5PM PST. Line TBD.this shit is so fucked for us europeans
>>538055538This is so silly lol. I love this song though.
>>538055323Sorry, I'd have to refuse that offer
>>537994326I work on that day so I guess my thread designated husband will be there by himself.
Hello~
>>538055967can i cumtribute this
>>538055967Made for type 1 females
I don't want to wait for launch. I want it now
who the fuck works on Saturday 5pm PSTit’s the last CBT, call out you fucking bitch you have more important thingsor we need a second meetup on Sunday
>>538055626It's saturday... you'd go out and have a life rather than suck 30yo boypussy?
>>538055538It's peak im afraid
Does Butts ERP?
does anyone want to meet up in another game after the cbt is over
>>538056668Nyes
>>538055967Made for bed breaking sex with T2 males
my unlovable D tier f2 will be attending the meet up alone and have fun regardless!!! or instead I uninstall the beta tonight and save myself the humiliation..
>>538056668I hope you’re into QoS
>>538056692Yeah, meet me at the
>>538056692what games do you like
>>538056493>it’s the last CBTplease dont remind me....
>>538056692not really
>>538056790wallflower with the other loners standing at the outskirts
>>538056715>>538056830Does she like type 1 females?
>>538056830Quality of service?>>538057124She loves me yes, so she's taken
>>538057054cute
>>538056692what games
What if the game never releases
>>538056912>>538057027>>538057072>>538057486ffxiv...
>>538057513This could be our last chance to... you know....
>>538056692Tera classique
>>538057513then we will be free from it's clutches until the next re-release
>>538057537You couldn't get me to resub to that kusoge
>>538056005>>538056108>>538056758!
>>538057537Hey, I also play that!
>>538057537oh, no thank you. i stopped playing that a long time ago.
>>538057624is tera even alive...>>538057679>>538057842PLEASE COME BACK>>538057696do you like femra...
>>538057876why? im a femlala on xiv. no one likes them. i mean look at kyo
>>538056692sure, we can meet at the gathering hub for some hunts
>>538057876I sometimes am a femra..
>>538057537kyswhat's your name
>>538055639>>538056624Glad you like it! Please enjoy this one too.
>>538057930people like normal ones
>>538058043>barely anyone compared to the last time
>>538058043>these are always taken when i'm not therei hate this place
>>538058095im normal and not lewd at all so im irrelevant.
>>538057876No. That game hasn't moved at all, let alone move forward, in it's design since 2017. I like new MMOs because they have the chance to grow. Sure Star Resonance isn't perfect but it's could grow to be better. Xiv has had all the time in the world to do that and yet it didn't
Anyone want there cock sucked? Meet me in the Quick Sands A.T
>>538057930femlalas are cute too tho...>>538057958i like other femra too a lot hi...
>>538058043this looks so bad since the BPM doesn't even match
Where do I trade in life skills talent points to get more? It says I can trade in 300 stamina for 1 but no idea where?
>>538058208You get them by spending the stamina bwo
>>538057695Butts is so beautiful... I want to ask her if she wants to futa my type 1 female but I don't want to make things awkward between us...
>xivgger spamming up his kusoge itt we all and by we I mean WE and I mean I speak for everyone, WE ALL quit after endwalker
>>538058184you gotta feel the groove. the jive.
>>538058272oh I'm dumb tyty
can someone show me maku's character
>>538058327>somehow still the fastest thread on /vg/I don't think they quit bros
>>538058368>>538045817
'ot 'layin 'inal 'tasy
>>538057695unironically one of the worst fem2/3s, there’s a reason your character was at the bottom of every tier list last night
>>538057876Tera is still alive. the big server we were all on will go back online soon and /vm/ is working on their own server currently
>>538058521Pygo and Miyu in their natural habitat
>>538057695let me smash already
I'm posting my F3 without permission.
>>538058630*wiggles ur spear*
>>538058514It's 70% stale replies to anchorposts and tribal posts about their choice of in game race. Not even drama or anything. Just vapid posts sent into the void.
>>538057695DO YOU LIKE BOYS
>>538058516figures he's ugly
>>538058680There's always drama. It just moves too fast for anyone to care. That and most people know it's thread narrative.
i will not be playing no vm tera pserver with eris, creep, coconut, ahoka, and towa, on everyone’s soul
>>538058589Wow it actually makes sense why this general was so shit
>>538058948I will if it has ninja
>>538006778You sound cute, I might keep an eye out
>>538058524He was on top of every list.
>>538058672*parries it and punishes you*
>>538006778>anon who wants a date puts themselves out there >nobody DMs her >replies calling her uglyAnd this is why, as a wallflower, I never post my character. The C tiers last night already broke my heart.
>>538058948you forgot lico, allegreza, sura, paps, barossa, moonchaser, mei, isuzu, idclip, redostay cliqued out NERD
>>538059064You're welcome
>>538059298>surabarf
Tell me everything you know about Pygo
>>538059298>sura nobody wants to play with that pretentious faggot sorry
>>538059298love alle
>>538059375They're in Yotsuba. You're welcome.
>>538059375Okay so you won't fucking believe this but basically they
>>538059353>Tfw shimapan is a dated trend nowGetting old sucks
>>538059375She needs to make another vocaroo wishing me goodnight.
>>538059375AND THEN THEY WERE LIKE
>>538059375Why don't you ask me in game
>>538059476shimapan is forever
>>538058043KINO
>>538058275>>538058524>>538058610>>538058749!!
>>538059375whats even crazier than what the other anons said is that
>>538059523do u need a date for saturday if yes ill whisper you right now
>>538045817why are you brown
>>538059527I wish it were so, anon...
>>538059375FAT FUCK
>>538059589I don't but thank you
>>538059614Anon, how old is your monitor?
>>538059701Who are you going with... is it seio? is it fucking seio....?
>>538059701>Pygo of all people has a fucking dateIM GOING TO DIE ALONE
>>538058545>Tera is still alive. the big server we were all on will go back online soonwhich one? i kinda wanna play
>>538059779Keep her name OUT OF YOUR MOUTH!*spits*
>>538059734I bought it second-hand in an ex-soviet country 6 years ago
>>538059561Do you want my type 1 female to futa you instead?
>>538059561Turn around
>>538059298>>538059356do you mean tsuranova i remember him from maplestory 2 i loved erping with him on discord ngl
>>538059375I talked with pygo (first name basis btw we are just close like that) and she said she hates all of you
>>538059791Mogged>>538059779Wait and see ;)
>>538059991yes i know sura mentioned this to me yesterday about you
>>538055967>>538057695>>538059561
>>538059375i think she's unironically taken and half of these posts are astroturfing
>>538060327God I hope EMV doesn't play this.
>>538060327I'll never understand the fascination with ham planet proportions. Those looks terrible.
>>538060327Extremely based from butts desu
>>538060327damn this game is ugly
>>538058184>/pso2/ggers caviling when anon posts something fun instead of discord screenshots or drama
>>538060237wtf no... stop lying...
>>538060327why are you leaking logs?
>>538060420He's in the thread shitposting and posting AI sloppa.
>>538060327Damn he roasted that crackhead
>>538060327based>>538060420he'd get filtered by the timegating and the gacha and the chat
>>538060327>people with shit like this on their computers are the ones telling you who's sane enough to talk toErmmmm
>>538060573Chat is only a problem cause of the lack of word wrapping and the controls to change channel.
>>538060470updoots to the left
>>538060714>>538060714>>538060714migrate when comfy
is pso2 or bp better when it comes to chat and screenshotting
>>538060327>im sorry I made that horse photoshopWhat?
>>538060681The chat honestly isn't that terrible compared to other games, and erp is doable.It'd still help filter him tho because emv is a dumb crackhead
>>538060327My favorite t1 is in this picture. :)
>>538060780It was actually a shitty mspaint drawing of butts with a horse head
>>538059248Auti..
>>538059918>>538059932>>538060327!!!
>>538066114need you to milk me dry again,,,
