[a / b / c / d / e / f / g / gif / h / hr / k / m / o / p / r / s / t / u / v / vg / vm / vmg / vr / vrpg / vst / w / wg] [i / ic] [r9k / s4s / vip] [cm / hm / lgbt / y] [3 / aco / adv / an / bant / biz / cgl / ck / co / diy / fa / fit / gd / hc / his / int / jp / lit / mlp / mu / n / news / out / po / pol / pw / qst / sci / soc / sp / tg / toy / trv / tv / vp / vt / wsg / wsr / x / xs] [Settings] [Search] [Mobile] [Home]
Board
Settings Mobile Home
/vg/ - Video Game Generals

Name
Spoiler?[]
Options
Comment
Verification
4chan Pass users can bypass this verification. [Learn More] [Login]
File[]
  • Please read the Rules and FAQ before posting.

08/21/20New boards added: /vrpg/, /vmg/, /vst/ and /vm/
05/04/17New trial board added: /bant/ - International/Random
10/04/16New board for 4chan Pass users: /vip/ - Very Important Posts
[Hide] [Show All]


[Advertise on 4chan]


File: 1774146029189308.png (763 KB, 735x968)
763 KB
763 KB PNG
Uuh fuck off bullies..

>Moogle Treasure Trove - (March 31st -> April 28)
https://na.finalfantasyxiv.com/lodestone/special/mogmog-collection/202603/lba1j4i815

>Patch 7.45 Notes
https://na.finalfantasyxiv.com/lodestone/topics/detail/2e8a10c44121af50ce86e1b605e10608e15f24d6

>Resources
https://rentry.org/xivgresources

>Meetups
• April 8, 9:00 PM EST | Primal, Famfrit, Lavender Beds W15 P20 | Spooky Club: Gaki no Tsukai >>562655897
• April 10, 10:00 PM EDT | Crystal, Mateus | Casual Queue Murder Meet >>562478015
• April 17, 4:00 AM PDT | Sophia, Materia | Eulmore, The Beehive | Live Letter Meetup >>562390635
• April 25, 10:00 PM EDT | Dynamis, Cuchulainn | Empyreum W27 P52 | RP Speedmeeting >>562561983

Previously: >>562964373
>>
File: korra retard cant mit.png (72 KB, 1103x477)
72 KB
72 KB PNG
>>
Hey post some lalas
>>
my galter character will be attending the cc meet whether you like it or not
>>
• April 10, 10:00 PM EDT | Crystal, Mateus | Casual Queue Murder Meet >>562478015
• April 13, 8:00 PM EDT | Primal, Exodus | Empyreum, Ward 26 Plot 34 | Homestuck Meetup >>562681351• April 19, 4:00 PM CEST | Light, Lich, Empyreum, W7 P48 | Frenchra movie: Pulp Fiction >>561912764
• April 25, 9:00 PM EDT | Dynamis, Cuchulainn | Empyreum W26 P51 Molly Bloom Orgy Meet >>562656776
>>
i am
a gay lalaboy
>>
someone bring out the borderline personality test anchor
>>
>>562975530
no one knows or cares what your numbers mean you babbling retard
>>
My moonie is freshly cleaned and ready to rock
>>
>>562975571
im pretty sure, but also im borderline enough to not post it if i got a high score
>>
File: 1772209405784952.jpg (249 KB, 2560x1440)
249 KB
249 KB JPG
>>562975389
My logs are literally more real than yours though? And I don't log my fights since I first cleared M11S in Jan twin. You can parse my nuts though
>>
>>562975530
I don't press Feint, you gonna schitzo me next?
>>
>>562975571
My moonie is very mild
>>
>>
>korra is insecure about his parses
lol
lmao
>>
we get it already korra got 7 damage downs and none of us care schizo
>>
File: 1764024763723655.png (2.6 MB, 1080x1920)
2.6 MB
2.6 MB PNG
Dude we love out ankh'd ebin!
>>
Is my schizo +?
>>
>>562975664
i can't imagine hanging around here when you have a girlfriend and obviously enough money to kinda do whatever the fuck you want
>>
Every time I get schizoed I bounce on it harder
>>
File: ffxiv_08042026_023048_572.png (2.84 MB, 1600x1200)
2.84 MB
2.84 MB PNG
>>562975571
my maliddie is posting it DESPITE my directions

https://www.idrlabs.com/borderline-personality/test.php
>>
>>562975812
im not your schizo but im
>>
They saying 5’4 the new 6’0!!!!
>>
>ZT
>>
guys are really getting into astronomy to find THAT femra
>>
when korra clears m12 with the huzz schizo gonna rope LOL
>>
File: 1738906642119385.gif (2.85 MB, 498x280)
2.85 MB
2.85 MB GIF
>>562975786
>out
>>
>>562975835
I been phoneposting whenever I'm working and when I'm at the gym :3 why you pocketwatching
>>
>>562975786
I'd love her if you know what I mean
>>
File: SOSEX.png (108 KB, 349x498)
108 KB
108 KB PNG
SEX WITH MOONIES!!!!!!!!!!!!!!!!!!
>>
File: 20260408_125445.png (320 KB, 526x566)
320 KB
320 KB PNG
You like?
>>
>>562975835
you really think hes telling the truth? lol
he was lying for a month about people wiping his M11s pulls but then some schizo found the logs and it was all him
>>
>>562975976
Leave my moonie alone goddamnit
>>
File: 1676493683539564.jpg (62 KB, 518x452)
62 KB
62 KB JPG
my femra has INFINITE power and could end all life everywhere across the entire universe with a snap of her fingers
the only reason she doesn't is because you're cute
>>
>>562975925
LMAOO twin ily
>>
>>562975918
I've been interested in astronomy for a long time, just not smart enough and/or disciplined enough to get into the field. But also big femra sexo
>>
>>562976026
I hope this is the femra I'm thinking of
>>
>>562976015
No come here!!!
>>
File: Kanna_Dance.webm (3.96 MB, 1162x1138)
3.96 MB
3.96 MB WEBM
we need more lowlanders
>>
File: ant.jpg (412 KB, 2560x1440)
412 KB
412 KB JPG
>>562976026
thank you femra i will remember your mercy...
>>
File: HFOT6WiXgAAvEnG.jpg (198 KB, 1463x1353)
198 KB
198 KB JPG
>>
File: fleeingmoonie.gif (1.01 MB, 640x468)
1.01 MB
1.01 MB GIF
>>562976142
Aiieeee
>>
>>562975980
>he's been spamming this all day as if anyone cares
>>
>>562976187
*eats you*
>>
File: 1772879786261306.jpg (17 KB, 225x224)
17 KB
17 KB JPG
>>562975891
LEMME SEE TWIN!!!!!!
>>
>>562976026
>infinite power
>only influencing a single universe
My loli OC could erase you with ease as well as the entire omniverse if she so willed it
>>
File: asdfasdf.png (30 KB, 232x76)
30 KB
30 KB PNG
thanks if u joined (i didnt win any gear)(i also died to vamp stomp 3 times because im bad at the video game))
ps. join my ia2 to clear m10s pf blease
>>
File: G8KopQKXcAEoiMz.jpg (344 KB, 1920x1080)
344 KB
344 KB JPG
>>
MALE MIDLANDERS?!?!?!??!??!
>>
>>562976026
my femra is a void, nothing, her soul is a black whirlpool circling round nothing
>>
>>562976298
and yet she still ends up with my dick in her mouth, curious
>>
File: bruh (2).jpg (238 KB, 960x993)
238 KB
238 KB JPG
>>562970484
bruh
>>
File: 1774984423099741.gif (56 KB, 128x128)
56 KB
56 KB GIF
>>562976207
p-please...
>>
>>562976026
my femra is immune to your femra because her existence is bound to forces beyond the boundaries.
>>
>>562976269
why do you want to see penis so bad
>>
File: 20250727_163606.jpg (592 KB, 3800x2160)
592 KB
592 KB JPG
>>562976159
>>
File: HDOxZrAXoAIkgWo.jpg (324 KB, 1369x2434)
324 KB
324 KB JPG
>>
your moonie is on my rape list
>>
>>562976350
Only her futa little sister's actually
>>
File: nuh.gif (309 KB, 491x465)
309 KB
309 KB GIF
>>562976370
Nyoo my moonie doesn't do that, you'll have to find one that does!
>>
>>562976026
y-you too sis....
>>
>>562976426
Forget the list, she goes to the block.
>>
>>562975530
It's the healer fault
they should have put their mit down
and crit their shield

Always the healers

I wish SE deleted healers
>>
>>562976440
yeah that's me
>>
File: 1754169576878441.png (418 KB, 575x829)
418 KB
418 KB PNG
>>562976090
>
>>
>>562976420
God I love femroes so much it’s unreal
>>
I saw all of your guys' posts.
/pet
/mdance
>>
File: GsIaTT3WoAAW2yn.jpg (1.32 MB, 4096x2772)
1.32 MB
1.32 MB JPG
>>
File: 1758887244210120.png (2.11 MB, 1920x1080)
2.11 MB
2.11 MB PNG
Gonna take a break from calls because I hate C9 and will cotinue calls after Cl*ud nine is over
>>
>>562976264
aieeeeeee
>>
>>562976513
looks kinda greasy
>>
>>562976380
I like seeing huzz, I don't care for just penis alone but seeing da whole twinem with da weenah hot lowkenuinely
>>
>>562976298
EB status??
>>
>>562976481
Shuts you up with her huge 42cm cock
>>
>>562976561
You will contribute greatly to my femra's breast fat. Thank you.
>>
Palaistra is the only good CC map.
>>
>>562976461
how about hand holding then....
>>
>>562976494
I can't believe I never saw this connection.... Maybe it was over before it began
>>562976571
EB'd to her imouto
>>
File: i feel it....jpg (632 KB, 1176x977)
632 KB
632 KB JPG
I sensed good things being posted.
>>
File: bruh.jpg (95 KB, 921x772)
95 KB
95 KB JPG
>>562975871
hm
>>
File: 1755162995618771.png (1.84 MB, 1080x1920)
1.84 MB
1.84 MB PNG
>>562976657
It's volcanic.
>>
>>562976729
well if she's already EB'd can my femezen be their pet...
>>
>LIST OF QOS/BLACKED EBINS

REKKA KEN
SEIKO GEISHEI
SARAN MIYAKE
CLOVER WEISS
RIKKA TSURUGI
GAR GALON
JUNIPER GLADEWYND
LHO ANWYN
HOLLY JOLLY
ARIA ORCHESTRIA
KYOUKOKO KYOUKO
SUN ROSA
SHERRI LAITELLE
EIKI SHIKI
REREKO REKO
MEIWOWO MEIWO
IKUA RA
LILIANE BLANC
SANDRIS NOLAN
HIHIMI CHERE
JEAN CHARLEMONTE
CHLOE SCARLET
MO FU
ARANDO PEAM
BRANDO PEAM
RURI TORA
MUFFY MOG
GRACE WELKIN
ATMA BUSTER
TOZER BEAU
SARAN MIYAKE
>>
>>562976026
>raen
uh huh
>>
>>562976657
sis u misspelled clockwork...
>>
Not enough lalas
>>
>>562975562
schizo post
>>
>>562976724
She'd have to think about it..
>>
File: 1754731063220894.png (509 KB, 1080x1080)
509 KB
509 KB PNG
my femra is unaffected and bored by the powerscaling argument because nothing exists outside her and you're all only powerscaling because she thought it'd be cute and willed it so
>>562976729
my femra sees all so I'm glad I could give you sight
>>
>>562976816
That’s a lot of darts anon.
>>
>>562976816
Mo Fu was only blacked for a week, she already left the discord a long time ago so you can remove her from this list
>>
File: 1674528234440.gif (3.78 MB, 498x370)
3.78 MB
3.78 MB GIF
Housing anons, please help. Are there any decently sized items that prevent camera clipping but DON'T attract wall hanging items?
>>
>>562976856
Correct.
>>
File: 1745729444043531.mp4 (1.73 MB, 720x754)
1.73 MB
1.73 MB MP4
>>
>>562976657
truthNUKEEEEEEEEE
>>
File: HFNfmV4awAEBAPa.jpg:orig.jpg (253 KB, 1080x1920)
253 KB
253 KB JPG
>>562976540
You should make more explicit stuff with her
>>
>>562976771
>>562976842
Palaistra is the best map
The only people who hate it are melee players mad they can't dive ranged classes
>>
>>562976816
muffy is black
how does that work
>>
File: 1775676007266.jpg (422 KB, 1371x2109)
422 KB
422 KB JPG
WE NEED
MORE
FEMLALAS
>>
my femlala's name isnt on that list because she's racist
>>
>>562976956
Eastern Indoor Pond
>>
>>562976901
what did i tell you about making me think you're more cute than I already do
>>
>>562976979
I can't ask this one to sit on my face, she tastes kinda funny
>>
>>562976996
There's a few non white characters on I wouldn't think on it that much
>>
my moonie has... grown... something...
>>
Whatever happened to Mo Fu? Haven't seen him or his boyfriend posting lately.
>>
>>562976809
We could be convinced, always need something to experiment with...
>>562976901
Hmm, well my loli isn't even the strongest being so be glad she allows to have your delusions
>>
>>562976159
what is that thing and why is there ash/soot smeared on its face
>>
>>562976816
saran is there twice
>>
File: 1760164097742865.mp4 (2.53 MB, 1280x720)
2.53 MB
2.53 MB MP4
>>562976961
>>
>>562977119
growing plants this early? good work, moonie!
>>
>>562977104
my bad
>>
>>562977148
Chemod
>>
>>562976939
>Mo Fu's boyfriend desperate to convince himself he's not a whore and he won't cheat on him again this month like he did last month
>>
>>562977119
Sis you should go to a doctor and get that checked…
>>
File: 1774254579945619.gif (438 KB, 112x112)
438 KB
438 KB GIF
>>562976901
powerscaling arguments are fun though... well as long as people are doing for fun instead of wanting to "win"
>>
File: 1767844319049679.png (1.08 MB, 1053x1069)
1.08 MB
1.08 MB PNG
>>562975557
>>
File: 1749754666830310.jpg (114 KB, 1080x1080)
114 KB
114 KB JPG
>>562977042
true
>>
File: 1756634866697813.jpg (1.99 MB, 2560x1080)
1.99 MB
1.99 MB JPG
my meena? bing chilling
>>
>>562977175
this is my fav thread femra. so pretty /pet /pet /pet /pet
>>
>>562976979
I'm thinking sexo
>>
My femra's favorite jobs? DARK knight and BLACK mage, why of course!
>>
>>562976816
bloonie doesn't even plap lmao
>>
File: 1761871518578367.mp4 (2.44 MB, 720x1280)
2.44 MB
2.44 MB MP4
>>562977175
>>
>>562977119
a sick crab hand?
>>
File: 1755868019240586.png (28 KB, 494x225)
28 KB
28 KB PNG
>>
File: 1749573902676640.png (3.14 MB, 1920x1080)
3.14 MB
3.14 MB PNG
>>562976979
But anon.I thought about making a femboy clown for that
>>
>>562977361
lmao
>>
The performative outrage around blacked gposes continues to be funny
>>
fr fr
>>
>>562976359
If I bought you dinner first would you...
>>
File: file.png (576 KB, 566x483)
576 KB
576 KB PNG
gumo i think i caught a cold or flu
surely this will not impact my ability to clear the raids today
>>562976816
who the hell did i get blacked by, the tyrant?
>>562977172
i think that means i got unblacked like a double negative or smth idk how that works
>>
>>562977042
Is that Kyoppi
>>
>>562976064
would
keep her pregnant and barefoot at alll times
>>
>>562977417
Sounds good
>>
File: G7vMiYVWwAAgo_o.jpg (200 KB, 1080x1920)
200 KB
200 KB JPG
>>562976420
Hey.
>>
>>562977424
yeah i'm sure you'll provide evidence any moment now
>>
We leaving blacked in 2025
We doing BLEACHED all of 2026
>>
>>562977424
He's right tho, I don't plap because it doesn't interest me
>>
>>562977305
>drawn in vagina bones
LOL the absolute state of femlalas, this is like painting your abs to look fit
>>
File: 1746737555977403.mp4 (1.84 MB, 1078x720)
1.84 MB
1.84 MB MP4
>>562977372
>>
>>562977402
"never end on a loss" niggas
>>
>>562977417
Awww I kinda wanted to see more sexy pics with her
Though I do kinda want to comm you more of a certain femboy lala
>>
>>562977531
theo you're south east asian you're not white
>>
>>562977469
twinem!!!!!

>>562976816
Do I not count cuz I am part black... wait I just realized I never got with a dark-skinned huzz back in da day!
>>
>>562977570
those are skin folds
>>
>>562977513
#NEEDTHAT
>>
File: 1772103402858673.jpg (68 KB, 500x500)
68 KB
68 KB JPG
YoshiP knocks on your door
Legend has it that only (You) know how to save FFXIV. He begs you for advice on what to do for the next expansion.

What do you say?
>>
>>562977570
trembling scaly hands typed this post
>>
>>562977458
why are you skinwalking korra with old pics bro
>>
/xivg/ x /blacked/ meet when? QoS tattoo mandatory. I wonder who'd show up...
>>
File: 1750120176563715.mp4 (3.2 MB, 1280x720)
3.2 MB
3.2 MB MP4
>>562977586
>>
>>562977570
those arent vagina bones
>>
>>562977704
“Make all the jobs even easier, get rid of all savage, ultimate, criterion, quantum content and put those resources back into repeatable casual content
>>
vagina bones?
>>
File: 282185218521.png (109 KB, 903x896)
109 KB
109 KB PNG
>>
>>562977734
that's just lightcord
>>
>>
File: fofo11.png (45 KB, 200x200)
45 KB
45 KB PNG
>>562977704
just commit with the gachafying plan yoshi piss. we know you are planning it
might play the game tonight
>>
>>562977653
whats good sis how is m12 going
>>
>>562977831
are you a biofem
>>
i miss grace welkin
>>
>>562977905
LOL
>>
>>562977905
yeah that's akemi
>>
File: 1774738721442894.png (357 KB, 998x998)
357 KB
357 KB PNG
>>562977704
Stop letting the tail wag the dog in FFXIV. Savage raids and Ultimates are fantastic content, but they shouldn’t be the primary force shaping the entire game’s design. The vast majority of players never touch that level of difficulty, yet so many systems feel built around it.
Criterion dungeons for example, if expanded and better rewarded, could teach players positioning, coordination, and personal responsibility in a more approachable environment. They’re smaller-scale, less intimidating than 8-man raids, and can act as a training ground without the pressure of Savage-level expectations.
>>
File: 1769670730178964.mp4 (715 KB, 720x720)
715 KB
715 KB MP4
>>562977774
>>
>>562976901
>posting the googoo babies horse
hmmm
>>
File: file.png (1.31 MB, 973x712)
1.31 MB
1.31 MB PNG
>>562975557
>>
>>562977972
She already said she doesn't know how Akemi is
>>
I tell people that some biofem ebins are trannies so that i can keep the biofems to myself
>>
>>562978028
any new pics of this boy's huge balls?
>>
>>562977972
but akemi is trans
>>
>>562977704
start silently cockwatching /xivg/ and discord servers and have modbeast ebins banned at random intervals
>>
>>562977905
Why are people obsessed if I'm a biofem or not :<
>>
>>562978069
favorite biofem?
>>
it's week 9 billion and korra "pentaweave" ikoma "I swear I'm not getting hardcarried everytime" still hasn't:
>cleared the tier
>gotten a decent parse
>had a week without a raiding incident
>learned how his job works
>learned how mitigation works
>learned anything
>>
File: 1761501478192571.mp4 (2.91 MB, 992x662)
2.91 MB
2.91 MB MP4
>>562977980
>>
>>562978054
akemi doesn't know who akemi is either so it checks out
>>
File: 1746162955606957.png (2.23 MB, 1365x1080)
2.23 MB
2.23 MB PNG
>>562975557
>>
>>562978152
why you pocketwatching twinem
>>
>>562978019
it's simply how my femra sees and dotes on the realities she creates
>>
>>562977901
WE GONNA CLEAR P1 TODAY!!!!!!!!!! Deadass im gonna ask each light party to seperate for slaughtershed so we can move quickly, everyone piles up in the middle
>>
>>562978069
FAVORITE BIOFEM THAT PUTS OUT??
>>
File: ffxiv_07042026_220447_311.png (1.5 MB, 1080x1920)
1.5 MB
1.5 MB PNG
>>562976843
Agreed, need more lalas.
>>
>>562978152
i havent done any of those things either wheres my schizo spammer......
>>
>>562975570
my lalaboy is straight but wouldn't mind being EBd to another lalaboy
>>
>>562978259
saran and mioh
>>
whenever my femra sees a femlala in a skirt she pushes them over so she can look at their underwear
>>
>>562978097
Only a wip pose file for a behind shot while in a moonie.
>>
https://files.catbox.moe/dwkx06.png
>>
File: Illustration.png (1.65 MB, 2200x2179)
1.65 MB
1.65 MB PNG
>>562977704
Say it, say my name!
>>
>>562978362
damn wish it was my sunnie instead, but also nice
>>
File: 1755710187288072.mp4 (1.95 MB, 652x1280)
1.95 MB
1.95 MB MP4
>>562978173
>>
>>562978396
No one gets mad at you for being the way you are.
>>
>>562978371
this is your goonbrain on steroids
>>
>>562978406
/pet /pet
>>
>>562978371
I don't know if I could say I have seen worse, but this doesn't phase me at all. Am I cooked?
>>
>>562978396
GRIMGOR IRONHIDE
>>
>>562978338
both trans
>>
>>562978267
WIFE.
>>
>>562978371
What domain expansion is this?
>>
imo i think powerscaling is actually kind of cute if it's like two kids playing with toys instead of people taking it too seriously
>>
I think I should reconsider my choice of twinem
>>
File: file.png (507 KB, 612x429)
507 KB
507 KB PNG
>>562978221
what we do in our static is we have supports inside the hitbox and the dps outside so you're stacked by role but still in the middle, and its easier to set preset spots to spread that way, you could do LP1 inside LP2 outside too though
>>
File: thinking-rope.png (70 KB, 498x330)
70 KB
70 KB PNG
>>562978371
>>
lol
>>
my sunnie+ is a blacked blonde bimbo slut with fake lips, fake tits, a fake tan, a BBL and of course spade piercings in all the right places, thoughts?
>>
>>562978497
WAAAAAAAAAAAAAAAAAAAAAGH!!!
>>
>>562978152
>learned how his job works
>learned how mitigation works
>learned anything
90% of the raiders I know don't do these, they just muscle memory every fight like they're one of these freaking things using guides as options to try out before discarding them on the pursuit to a tasty treat through bruteforce https://www.youtube.com/watch?v=75k8sqh5tfQ
>>
File: 1772206890351324.jpg (277 KB, 1152x2048)
277 KB
277 KB JPG
>>
>>562978371
Crazy domain expansion
>>
does db have a ritualpost for every ebin
>>
>>562978518
nah saran is bio, it's shan who's a troon/femboy/whatever
mioh is TBD, has transGAM goontendencies but expressed in the manner of a woman whose eggs are rapidly drying up
>>
>>562977704
>Fujo full time on XIV forever or at least get other writers of the same caliber like Naotaka Hayashi
>Fire the shitty writer(s) IMMEDIATELY- they are poison
>Stop fucking around with other shitty projects and double down on XIV
>Figure out how to better utilize recycled/old content (limited jobs are not the answer)
>Skim out as much old MSQ filler episode shit as possible to make that overall shorter
>Do a better job of actively & passively teaching your players how to both play and IMPROVE in your game. Casual fags can be easily converted to decent players which means they have way more they can do.

Or just burn it all down and make MMO#3
>>
>>562978543
is it me
>>
>>562978371
What’s the sure-hit on this domain?
>>
>>562978651
Name one, a random one.
>>
>>562978531
what if it's 35 year old gams arguing about bardock vs omniman for 8 hours?
>>
>>562978396
Roshan
>>
File: ffxiv_dx11_BAU3KflEF11.jpg (935 KB, 1646x1196)
935 KB
935 KB JPG
Thoughts? Wanted to keep it mostly vanilla, I'm sure there's a better hair/eyes mod, but a tiny bit of limbals in glamourer emulates the look well enough. Is there a way to remove almost all color from the lips without lipstick?
>>
>>562978741
the fat hroth one
>>
File: flipsurcat.gif (1014 KB, 273x498)
1014 KB
1014 KB GIF
>>562978519
Im gonna touch you.
>>
>>562978787
No one gets mad at you for being the way you are.
>>
>>562978771
That's really good, nice work
>>
>>562978673
>zero evidence
nice try chaser
>>
>>562978741
Lho Anwyn
>>
>>562978771
God this is so cringe
>>
>>562978771
without lipstick no
>>
>>562978827
Why am I getting namedropped so often now
>>
>>562978746
that sounds like taking it too seriously which is covered in my post
>>
>>562978827
EU Muffy Mog.
>>
>>562978827
EU Muffy Mog.
>>
>>562978547
wait thats acc genius, im using this. gonna try and queue for a p1 clear rn, also ty for da mods earlier this week! The Serif font kino
>>
>>562978708
mpreg
>>
>>562978267
yeah that's a wife
>>
>>562978673
they're all bio
>>
>>562978741
berke
>>
>>562978893
Nigga did you just skinwalk me bro.
>>
>>562978932
bioGAMs
>>
File: file.png (76 KB, 212x193)
76 KB
76 KB PNG
>>562978904
npnp, gl twin u get that clear
>also ty for da mods earlier this week!
that was me wife not me
>>
>>562978874
FAVORITE BIOFEM????
>>
>>562978980
Are you stupid?
>>
>>562978958
He hasn't posted all that much and mellowed out.
Miki Simp.
>>
>>562978874
You probably pissed off some autistic by not letting him plap
>>
>>562979001
I dunno man I don't really care for posters genders irl
>>
>>562978531
I like the unique exploration of powers rather than just one character being stronger than you times infinity + 1
>>
File: bwuh.jpg (327 KB, 1113x1719)
327 KB
327 KB JPG
I think I wanna do some disgusting fish poses, do you prefer emotional disgust or visceral?
no it's not gonna be lewd
still can't believe she said that
>>
back in my day we confirmed biofems with tits or gtfo
>>
No matter how hard you try you cannot force people that do not want to raid into raids that’s not how it works.
>>
>>562978874
you've been posting a lot specifically to be identifiable
>>
>>562979027
Yes.
>>
File: ConcernedElezen.png (3.22 MB, 1920x1080)
3.22 MB
3.22 MB PNG
>>
File: file.png (181 KB, 609x416)
181 KB
181 KB PNG
LETS DO THIS!!!!!!!!!!!!!!!!

>>562978994
oop mb... ty for advice doe yuh yuh
>>
>>562977704
Consoledate the buttons for pve like you did for pvp you stupid fuck.
Play a game of Frontline or cc once in your stupid Japanese life before you put a update out. Take a look at all the BH5 retarded invincible gun rebreakers running around with the invincible paladins and ultra EZ mode monks.
Stop sinking our stupid fucking money in shitty flop games and roll hard in qol and the new in our game.
Push updates faster, give more emotes and content.
The next expansion should come out in half the time.
Remove the report function for chat, it will regulate itself
>>
>>562978874
Congratulations, the swarm has decided to try to turn you into a lolcow. I would advise not acknowledging it after this point if you would like for them to get bored and move on to a new target.
>>
biomalezen here
>>
feels like every online dating success story i see, including xiv, is just when the woman puts in actual effort or randomly becomes obsessed with a dude for whatever reason
>>
File: 1767149852044.jpg (259 KB, 618x559)
259 KB
259 KB JPG
>>562979092
>>
>>562977460
I told before that I would only with someone I know well...
>>562978679
It's probably you....
>>
>>562979092
>still can't believe she said that
?
>>
>>562979092
Visceral, why not.
>>
>>562979093
Saran and Shan both have posted theirs but Mioh reverse psychologyed the general into submission
>>
>>562978920
Hehee thank you :3 /pet
>>
File: 1750937209501291.png (483 KB, 736x736)
483 KB
483 KB PNG
8:50 CC ET Crystal
>>
>>562978741
Korra
>>
>>562979238
>Saran and Shan both have posted theirs
proof?
>>
>>562979050
I've been outspoken about not wanting to do any of that so I doubt it
>>562979108
I mean I've always gone through periods of posting the moonie more often and then less. Most of my posts are still anon
>>562979153
/shrug just odd to see is all
>>
>>562978874
>spam the thread with pointless shit every day
>why am i getting namedropped
you also reply to everything so go figure
>>
>>562979275
korra so creepy
>>
>>562979169
the latter is just your standard BPD whores bro, those are usually followed with the girl cucking the guy or breaking up with him out of nowhere it happened to me, NEVER go for a woman who's interested in you from the get go
>>
>>562979092
sum sweet and sowah
>>
>not in the 'cord
>>
>>562979169
that's generally how dating works yeah
good luck!
>>
>>562979169
That’s what happened with me.
>>
>>562978994
you really posting titties twin? >>562979238
>>
>>562979136
>Stop sinking our stupid fucking money in shitty flop games
>he thinks the former director of an MMO can tell the publishers want to do
>>
File: ffxiv_dx11_a55xK2J5D81.jpg (1.44 MB, 1149x2021)
1.44 MB
1.44 MB JPG
>>562978820
Thanks, I would take more angles but I feel like to make it any better I would have to go into C+.

I wish we could customize philtrum width separately from the nose... I dislike the "dual dot" style of anime nose so the nice bridges of face 2 midlander is a good solution.
>>
>>562979136
>Remove the report function for chat, it will regulate itself
Dude wants to flame people and be toxic without the possibility of losing his account
>>
>>562979125
Hello.
>>
>>562979281
the proof is a discord screenshot of a bunch of simps in saran's discord saying "omg she just posted her tits" after she said to type that
>>
>>562979345
i am going to kill myself
>>
>>562979169
you posted this shit yesterday
>>
>>562979307
I've done this for years that's the thing
>>
>>562978353
>she pushes them over

The average femlala has equal to more mass than a femra and can easily 1 v 1 your skinny ass
>>
File: faceless.png (312 KB, 795x751)
312 KB
312 KB PNG
>>562977302
first one of the day
>>
>>562979340
why did you get 7 damage downs
>>
>>562979092
I want you to suffocate me with your disgusting feet until my mind goes blank and I pass out
>>
>>562979136
>Remove the report function for chat, it will regulate itself
You will not say SLURS IN CHAT
>>
>>562979169
If a woman genuinely finds you interesting, for whatever reason, she’ll do everything in her power to get your attention.
>>
File: 1746461389380895.jpg (586 KB, 1080x1920)
586 KB
586 KB JPG
>>562978221
korra if you wanna talk about m12/need a paladin you can hmu any time
I'm parked on crystal for the next few days doing oc so might be a lil bit hard to find me in game but I'm usually around
>>
>>562979460
and ramped it up recently to annoying levels
>>
File: 1684043495920935.png (2.57 MB, 1912x1080)
2.57 MB
2.57 MB PNG
>>562979437
Hello!
>>
>>562979204
>someone I know well
You're EU and I'm NA
It can never be...
>>
>>562979169
That's usually how all dating goes.
>>562979416
Outdoor lighting might be kinder if you're still torn on her colors. Fog/Overcast at 11am-2pm is the light hack most people use.
>>
>>562979482
Ew.
I'm not a left lala.
>>
>>562979579
If you say so man, I wouldn't say I've changed the amount I post overall but for sure I've been posting the bloonie more recently
>>
transpiracy theorists on both sides are just making shit up now and beamclashing their made up shit
>>
File: 1766532705153605.png (2.64 MB, 1920x1080)
2.64 MB
2.64 MB PNG
Soupy...
>>
>Rue
Dropped.
>>
what if we made new characters with identical appearances and we roleplayed as twins?
>>
>>562979491
Well... Whilst I was progging before clearing M11S, I was still learning orbital stampede and during the roundabout section of it, I accidnetally stopped just a bit short of the clockwise movement, tanking 5 AOE puddles at once, the other two DD's came about from Orbital stampede, one during the first one and one during the second!
>>
File: ffxiv_08042026_224635_429.jpg (1.1 MB, 2560x1440)
1.1 MB
1.1 MB JPG
These guys look very heterosexual.
>>
>Korra still butthurt about being a shitter
lol
lmao
>>
File: gaia_ryne.png (990 KB, 920x778)
990 KB
990 KB PNG
>>562977704
add an active time maneuver where you have to get Gaia and Ryne pregnant
>>
>>562979715
what if they, y'know..
>>
pretty funny watching them scramble to find a new target now they finally figured out that lientri never entertained them
>>
>>562979643
I manually turned the "sky saturation" in brio to 0 there, is there a better way? Good point about the hair, I just think brightly colored hair in xiv looks WAY too cartoony
>>
File: 1751139488325654.png (1.88 MB, 1025x921)
1.88 MB
1.88 MB PNG
Ecks Eye Vee Gee
>>
>>562979732
rude
gonna tell them you said that
>>
>>562979169
I did this to a male middie from here and we’re happily together :3
>>
>>562979672
transvestigators chasing after transpiracy theories during their transvestigation
hehe
>>
>>562979715
only if they're both lowlanders
>>
>>562979574
RAHHH!!!!!!!!!!!!!!! TY TWINEM!! I'll hit you up when im progging P2 fr fr, im heading to NYC tomorrow so imma not be on till like sat night fr fr...

>>562979676
this deadass one of the top fiddies
>>
File: 1768536354723973.jpg (1.42 MB, 2160x3392)
1.42 MB
1.42 MB JPG
>>
what if I made my galter a korra clone so when he says twin he means his twin
>>
i still haven't cleared m11s...
>>
>>562979828
How did you get into AQ from FF14?
>>
>>562979825
I just fiddle with the time and weather and leave the rest alone because I'm stupid, but there probably is a better way to go about doing it.
>>
>>562979828
i look like this
>>562979908
GOOD LORD
>>
>>562979908
hey just wanna say thats awesome
>>
File: file.png (103 KB, 363x271)
103 KB
103 KB PNG
>>562979367
it was a pic of a plushie i was hugging with my chest in frame and i deleted it after realizing that it didn't really need to be there since i sent it on impulse
>>
>>562979672
>>562979902
please take a shower and go outside
>>
File: 1759952805657344.png (1.33 MB, 736x1020)
1.33 MB
1.33 MB PNG
11:40 CC ET Crystal
>>
>>562980061
why... I just think the terms are funny
>>
>>562979792
kissed...?
>>
>>562980059
autistic women are so cute bros it's unfair
>>
File: Genny.png (54 KB, 210x240)
54 KB
54 KB PNG
>get rescued into a mechanic THEY messed up
ihateyoudiediediediediediediediediedie
>>
>>562980059
nigga in the nsfw channel?
>>
bored
>>
File: file.png (292 KB, 750x524)
292 KB
292 KB PNG
>>562979908
>>
>>562980159
you gotta embarass them like saying "you really wanted me to fail that with you didn't you"
>>
i think i accidentally stumbled into a discord server can someone point me towards the final fantasy xiv discussion thread?
>>
>>562980059
ahhhHhhh I’m dyingggggg
The doctors say the only thing that would save me is that picture aghhhhhhhhhh
Pleaseeeeeeeee don’t let me dieeeee pleaseeeeeee ahhhh
>>
>>562980260
Hi bored I'm moonie
>>
>>562979562
I think I'm just radioactive because after the last few years of cultivating some personal hobbies, getting in shape and being generally happy with myself, I still have never had a woman show an interest in me in that way in my life.
>>
File: summer_gaming.png (3.15 MB, 1920x1080)
3.15 MB
3.15 MB PNG
Ocean fishing boat in just under 10 minutes, join on Aether for an attempt at Hafgufa and Placodus!

>>562975557
lalafell :]
>>
File: 1745245725454000.png (82 KB, 260x351)
82 KB
82 KB PNG
>>562979297
You're getting acknowledged because you're well liked.
>>
>>562975557
I've consoomed, and I don't regret saying this, this bike is cool
>>
>>562977224
Doesn’t that involve some kind of drama in order to push them out? They were here one day and then not the next
My bet is on alts
>>
>>562980363
rape
>>
>>562980302
I got you king https://www.reddit.com/r/ffxiv/
>>
qrd on chloe scarlet
>>
>>562980059
I'm going to need to see those plushies in my DMs, the tits too, but mostly the plushies.
>>
File: 1746243314971926.jpg (109 KB, 905x1232)
109 KB
109 KB JPG
>>562980363
Put on some skimpy panties.
Ass shot of you riding it.
Now.
>>
>>562980421
pink
>>
>>562980363
it's so fucking small on lalafells even though it shouldn't be, it's the same size as the other bike mounts when this bike is supposed to be much bigger than them
>>
>Face 3 lalafell
I laugh.
>>
>>562980302
he says not talking about ffxiv himself
>>
>>562978673
I'm genuinely interested in it if you have anything specific pointing to Shan not being female. I'm on the fence because interacting with them feels like interacting with the biofems I know.
>>
>>562977148
People say they started new elsewhere which is makes sense with their archetypes but I haven’t been able to find anything on them
>>
>>562979969
nanomachines.
>>
File: research.png (12 KB, 337x386)
12 KB
12 KB PNG
>>562980317
still cute
>>
>>562980363
Need you giving me a reach around while we ride that bike.
>>
>>
>>562980547
waaaaaaa you're so good at these, I'm so lucky ;w; thanks again ^^
>>
why do EU people care so much about what other people do?
>>
>>562979664
Use critical thinking, nigga.
>>
File: 673428923408.png (1.08 MB, 715x885)
1.08 MB
1.08 MB PNG
He doesn't know it yet but he WILL be mine

I just need to get trapped in the crystal tower together at the end I think I can do it
>>
>>562980330
Maybe, maybe not. I know for sure my posts would annoy some as that is the nature of this site as a whole
>>
File: 1754846430750918.png (2.47 MB, 1920x1080)
2.47 MB
2.47 MB PNG
>>562977617
yeah sure
>>
>>562980496
GAMs tend to act overly feminine
>>
>>562976026
Femra will say this to your face and expect you to take it seriously while they look up at you from 4'11".
>>
what if we stared into each other's eyes...
>>
>>562980678
I should have made a catboy galter
>>
File: file.png (330 KB, 924x1093)
330 KB
330 KB PNG
>>562980140
when i was in hs i was friends with a really cute aspie fujo who walked everywhere on her tipitoes despite being like 6'1" but nobody was willing to approach her because she was really autistic about stuff she liked, she is to this day one of my best friends
>>562980239
we go a lil off topic
>>562980306
sorry buddy you're off to the shadow realm
>>562980461
im not posting THAT pic but i do have a lot of plushies, my fav is this triceratops i pulled from a crane game at a gatchapon cafe that i take camping and this tonberry one of my best friends sent me for my birthday
https://files.catbox.moe/z56sdd.jpg
>>
Aye how do I
Is anyone around to help me clear P1 of M12S tonight? going to gym in like 20...

>>562980059
twinem posting da sonic plushies

>>562980421
huzz!
>>
>>562979648
I'll turn into dust now
>>562980640
Wasn't sure if you saw that drawing I have all of my stuff tucked away. Glad you liked it
>>
Should I log into my shotabait fiddie or play something else
>>
>>562980678
bitch comb your goddamn hair
>>
>>562980656
Bit rude asking a moonie to think
>>
>Rue
Dropped.
>>
File: 1759594648748106.png (101 KB, 608x1059)
101 KB
101 KB PNG
>>562979136
Tell me this isn't you without telling me this is you
>>
>>562977148
they broke up. mo fu is laying low to avoid schizos and his boyfriend went back to /pso2g/. chloe was bragging about breaking them up for a couple of days, but cut back on mo fu's request.
>>
>>562979158
I'm more of a full metal field malezen myself.
>>
File: 1744977968563354.png (210 KB, 615x601)
210 KB
210 KB PNG
The absolute fiendish behavior when that fat booty GAN-lala posts is crazy.
>>
>that moonie with ALL the braincells
>>
>>562980815
ill harass you if you do
>>
>>562980708
Yeah, that's my point. She talks normal but clearly has politeness beaten into her. Have you ever interacted with this person? I said I was genuinely interested in hearing what you have.
>>
If Korra said he f/w'd me I'd probably change my name and move to Canada
>>
this is what happens when a NEET has nothing else to do with his life
>>
>>562980909
me
>>
>>562980759
what if the tips of our fingers touched, and then we pulled our hands back a little, but then we did it again, slowly...
>>
this game kinda sucks ngl
>>
butch biofem playing a male character eb for my hyperfeminine girlypop gamra
>>
>>562980890
Me when I have no idea what i’m talking about
>>
>>562980771
well im completely shameless so im asking for it next time i see you and you're not at work
>>
>>562980909
is it me
>>
>You don't get it, I'm a SERIOUS roleplayer
>I need PLOT bro

Cmon, stop beating around the bush, you just wanna fuck my g
>>
>>562980909
It'll never be my moonie..
>>
>>562980363
it was fun drawing this ones big butt yesterday
>>
File: 12467234234.png (1.21 MB, 813x1010)
1.21 MB
1.21 MB PNG
>>562980760
It's not too late! Join us!

>>562980818
Nope
>>
File: 1761252281591105.jpg (284 KB, 1805x2236)
284 KB
284 KB JPG
if your femlala isn't hypersexualized with huge thighs, huger ass, hugest butthole and giant breasts you're basically a pedophile
>>
>>562981014
towa....
>>
>>562980958
and then instead of touching our fingers again, i move past yours and take your entire hand in mine instead...
>>
>>562980931
How would you do that?
>>
>>562980623
>>562980416
oh my goodness gracious

>>562980465
later, going to primal.

>>562980479
Small indie studio. Can see it's got almost the same animations as the Air Wheeler, idling and moving, at least.
The Garlond GL-IS was the last bike they made that didn't scale, right? I don't know if anyone complained about it.

>>562981032
thank you again, anon.
>>
>>562979169
yea pretty much. ive done this to a guy twice, one was a good relationship that lasted 5 years and only ended due to circumstances outside our control, the other is ongoing but has been great and looks promising for the future too. other relationships that i didn't pick out the guy i was interested first, but rather let someone pick me out, all had troubles of one kind or another and usually ended within 6 months or less.
>>
Race+gender posting
Nothing else matters
This is why we play xiv BAYBEE!!!!!!!!
>>
>>562980890
this is probably bs but I kinda hope its true
mofu doesnt deserve to be happy
>>
>>562980140
you say that, but thats until you actually have to deal with them. i think the idea is more attractive than the day to day reality of being with one.

unless u have the same type of autism urself
>>
File: 1772941276675252.jpg (3.17 MB, 1526x10000)
3.17 MB
3.17 MB JPG
>>
>>562980121
What if we had a kiss x sis dynamic...
>>
File: 1766071860793402.jpg (762 KB, 2560x1440)
762 KB
762 KB JPG
>>562981017
can't i want a little bit of both for the most enjoyable experience
>>
>>562981113
duskwight female
:D
>>
>>562981063
By sending you horrific tells on my shota, duh...
>>
>>562981113
He says not talking about the game
>>
>>562980690
You're not hated in a sincere light, how schizos operate is like this, and this is speaking from experience.
>Go after someone that gets little to no drama or attention
>Say something completely new to catch their attention
>They either respond defensively or confused
>Don't elaborate to them to leave them curious and questioning of their situation in current space
>Keep doing it to cement it further on every encounter
>Other people show up to defend them and argue either for you or against you
^ This is the part that matters most. That OTHER people like you. That OTHER people get dragged into the mess. This is what is getting you attention more and more.
For every,
>EU Muffy Mog
There's a person that goes,
>No, not even close.
Then you keep reeling in that engagement. People pay attention to ritual posts for any "anomalies" or "differences" and then focus on them more and more. It's not about hurting you to them, it's about using you as a medium to make a mess. That's how schizo shit always works.
>>
>>562981164
Yeah, I guess. This is probably the way, in fact. I just get annoyed by ""SFW"" roleplayers acting all high and mighty for no reason
>>
>>562981157
Thatd just be ripping off the shanran duo you should do a mom daughter relationship instead
>>
>>562981087
Hello my wife
>>
>>562980885
>giving reason
um xixtexr they no longer give reasons
>>
>>562980059
>>562980771
is this saran or shan?
>>
>the one time I don't thirstpost him he responds to thirstposts
its over
>>
>>562980903
I'm not gay but I would genuinely tear that nigga apart. He's so fucking thick, god. Reminds me of Timmy Thick
>>
>>562981164
>hitto in the background
>>
File: ffxiv_08042026_052852_005.png (1.73 MB, 2560x1440)
1.73 MB
1.73 MB PNG
welcome to hell, retard, ur the first one here
>>
Moonie for my face 1 fem(this stands for female btw)ra plox
>>562981176
So true sis
>>
>>562980701
What are your price now?
>>
File: 1761050761328304.png (1.12 MB, 1351x979)
1.12 MB
1.12 MB PNG
>>562981401
Damn bitch, you fart like this?
>>
when moonies aren't on the screen

anon should be asking "where's the moonies?"
>>
>>562981086
Gonna queue up for RW so I can cop a feel on this he/him bustyboy…
>>
>>562979715
with how few good character options there are most of us already have at least one of these already
>>
File: 1762494997937156.png (92 KB, 564x564)
92 KB
92 KB PNG
>>562981367
>i have relationships with women and sex with men
well i got news for you, king. that means you're gay
>>
>>562981173
How come I think you’re lying…
>>
>>562981324
I accept your concession
>>
>>562980909
this is absolutely my moonie
https://files.catbox.moe/a146k9.mp4
>>
>>562981449
I say this but for Khloe Aliapoh ToT
>>
>>562981481
we need to have the same surname and be on the same world so we can EB
>>
File: 38f5cffc6a.jpg (1.04 MB, 3169x2880)
1.04 MB
1.04 MB JPG
>>562977704
romance options
>>
File: 1772590166487695.png (391 KB, 520x619)
391 KB
391 KB PNG
My femlala woke up with brainfog
>>
File: ffxiv_08042026_053721_207.png (2.11 MB, 2560x1440)
2.11 MB
2.11 MB PNG
>>562981447
those are vapors from the swamps of boiling sulphur
>>
File: 1753639055883670.png (1.13 MB, 736x981)
1.13 MB
1.13 MB PNG
5:10 CC ET Crystal
>>562981434
DM me
>>
File: 1000008912.jpg (102 KB, 712x1024)
102 KB
102 KB JPG
>>562981367
Timmy thick mentioned
>>
What is the proper way to mark your character as + on flist?
>>
>>562981509
Because honestly there are a lot of people shitposting about them here that don't actually have them, so I don't blame you. This is one of the few times it is not shitposting
>>
>>562981270
it's just more fun with a little bit of foreplay and set dressing and surrounding plot
not that i partake much lately..
>>
>>562981581
stop huffing cock musk before bed
>>
>>562981401
loathsome dungeater ending

>>562977704
rape options
>>
>>562981>>562981594
That looks like stink clouds. Just letting you know.
Reconsider.
>>
>>562981147
I don't care. People cheating in PvE content doesn't affect me.
>>
>>562981581
I read that as brainfrog
>>
name a femra QUICK
>>
>>562981594
it's incredible how repulsively gay you look
>>
>>562981581
my femlala wants you to take this /hug
>>
>>562981647
I posted this last year KEK
>>562981508
Nahh I'm str8 as an arrow
>>
>>562981661
Cuteeeee! What do you do? RP or animations?
>>
yeah I'm lowkey a freaky nigga who wants to suck on Otis' toes what of it
>>
>>562981807
korra
>>
>>562981807
THAT one
>>
my femra basically invented mustard
>>
>>562981819
/happy
>>
>>562981647
Why do men marry women anyways? They get old, flabby, ugly, and they don't even give good head like a man does
>>
>>562981842
Thanks for the update
>>
File: file.png (4 KB, 208x46)
4 KB
4 KB PNG
>>562981331
yes
>>
>>562981807
Tamashiro Furukane
>>
wtf is a left lala?
>>
So is muffy also pale glint?
>>
>>562981807
I wish I knew her name... But she's a cute pale face 2 xaela
>>
File: 1774453487814521.jpg (105 KB, 1024x908)
105 KB
105 KB JPG
>>562980363
>>562981086
>A lalaboy gets to pound that every night.
>>
>>562981825
RP, animations don't really look good normally and they especially don't look good on smaller bodies. Maybe throwing them into a scene if setting it up with heels doesnt take too long...
>>
>>562981807
Ranru
>>
>>562981921
no
pale glint is medium lady
>>
>>562981953
I’ll have to find you one day then
>>
aye deadass shoutout saphhic love
>>
>>562981254
That's one way to look at it for sure, but I'll still assume there's a non zero number of posters that dislike my posts as that's most likely the case. Either way I'll still post bleppers
>>
>>562981579
It will end like this!
https://files.catbox.moe/2fy55z.png
>>
File: 1746227053332394.png (1.12 MB, 1046x984)
1.12 MB
1.12 MB PNG
>>562981447
>>
who the fuck gets on this game and says "yup im gonna turn my male lalafell into a femboy shortstack with a fat ass"
>>
>>562981807
Thread Schizo
>>
File: 1755733267543980.png (2.89 MB, 1080x1920)
2.89 MB
2.89 MB PNG
A Moonie approaches.
>>
>>562981917
A left lala or otisfell is basically a shortstack lalafell.
We have a chart for this
>>
>try to load a pose in anamnesis
>it throws an error about not being able to manipulate bones
>brio can pose just fine
time to take this program out back
>>
>>562982095
Nasty!
>>
>>562981850
I give it a year before he troons out. He’s already a femra playing parsetroon and he’s only been playing the game for like 6 months.
>>
>>562982015
Could be today if you actually do hop on your fiddie!
>>
>>562981754
wookie cheats in pvp
he forgot to turn it off for pve
>>
File: 29-55-448.jpg (2 MB, 2160x3840)
2 MB
2 MB JPG
>>562975557
K
>>
>>562982091
unironically my favorite critter
>>
>>562982095
Album?
>>
>>562981050
jesus thats an ugly character
>>
>Rue
Dropped.
>>
>>562982084
weirdos
>>
I see a fellow hrothgal
I hit the /hum
Life's simple like that
>>
Bros I had a dream about someone from xivg the other night and it felt like a blessing from the skies above itself.
I woke up yearning hard but I have never interacted with this person and have no feelings for them. What the fuck
>>
>>562982154
I genuinely don't give a fuck, dude.
>>
>>562982095
>Hair clipping through the breast
God this retard faggot is fucking useless.
>>
when did showing passion for your friends start getting viewed as desperation, i tell someone i had a good time and want to hang out again and they disappear...
>>
>>562981579
Gaia every time, final answer.
>>
>>562982256
Who was it, king..
>>
>>562982095
my fave moonies that is built for wrapping around like a body pillow
>>
Hey
I miss you
/pet
>>
File: 7b07aa9a0a0b259a.webm (69 KB, 800x406)
69 KB
69 KB WEBM
>>562982029
>sapphic
TRANNY TRANNY TRANNY TRANNY
>>
>>562982284
so stop replying
>>
File: 1765235974813735.jpg (28 KB, 906x631)
28 KB
28 KB JPG
>>562982223
>>562982084
These are jealous femlala posts.
>>
>>562982289
Treat me like shit and i’ll stick around longer
>>
File: 1751773116346247.png (305 KB, 539x625)
305 KB
305 KB PNG
>>562982063
This is honestly terrific, I can't lie. Good work.
>>
>>562982029
are you a tranny
>>
>>562981814
yeah, thats the idea.
>>
>>562982357
"No."
>>
what game should i buy on steam so i can play something that isn't ffxiv
>>
>>562982289
How do you know they think you are being desperate? Maybe they just don't like you that much and don't want to hang out again.
>>
what does sapphic even mean? sometimes you act like a whore???
>>
>>562982256
They like you and theyre trying to worm their way into your minds through dreams. It is a dark art. Take care of yourself.
>>
>>562982284
You should.
>>
>>562982357
Stop posting that shit then, why do you care about some dude cheating so much? Do tell me.
>>
File: mask.png (110 KB, 280x378)
110 KB
110 KB PNG
Does anyone have any good mask mods they can recommend for female characters, particularly Venetian or masquerade-style masks, ideally full face?
That's something I find really hot but almost never see anywhere, and I want something to recommend to a couple of friends who are thinking about gpose commissions with my character.
>>
>>562981807
???
>>
>>562975871
>>
How long before we get an influx of he/him bustyboy malelalas?
>>
>>562982095
>>562982287
he has brown skin so he doesn't think beyond bobs and vagene
>>
>Lalafel
Dropped.
>>
>>562982403
>>562982436
thanks for your caring
heres more
https://www.fflogs.com/reports/QJxzGhZbYK1Caj7X?fight=11&type=damage-done
>>
>>562982436
Why do you care about some dude posting about him cheating so much?
>>
>>562982419
relating to sexual attraction or activity between women.
>>
>>562982419
it means lesbian but includes women with girldicks
>>
>>562982429
Oh? And why is that.
>>
>>562982342
>>562982389
nah cishet man irl I just be inclusive fr fr
>>
>>562982256
God i wish it was me
>>
>>562982342
Honestly I find fat women use sapphic more than anybody else.
>>
>>562981915
really fucking cute femrar btw
>>
>>562982565
>>562982419
it's closer to bi and does not include newhalves
>>
File: 567.png (1016 KB, 979x1364)
1016 KB
1016 KB PNG
>>562982550
thats impossible, cuz only men are capable of real love
>>
>>562982469
this post explains a lot of the schizoing happening right now
>>
File: 1774514729139212.png (1.34 MB, 1076x1159)
1.34 MB
1.34 MB PNG
8:45 CC ET Crystal
>>
File: 1772556715366910.jpg (44 KB, 637x114)
44 KB
44 KB JPG
>>
>>562982572
/smile
>>
File: 1748842364651905.png (2.43 MB, 1080x1920)
2.43 MB
2.43 MB PNG
>>562982287
is there a mod that adds bones to the omega-f hair because that shit is annoying as fuck
>>562982331
moonie soft and warm
>>562982497
post your dna sequence and if you are even one percentage point more aryan than me i will never post again
>>
>>562982727
but it says low???
>>
File: 1768240275908364.png (533 KB, 1200x900)
533 KB
533 KB PNG
>>562975871
>>
>>562982741
am i allowed to queue for cc
>>
>>562982438
I saw one like that on unvaulted, let me see if I can find it. Is this a femezen because I'd love to see the results..
>>
can I get a qrd on the he/him pawgafell
>>
>>562982779
Eugh!
>>
>>562982816
depends on what job you play
yes
>>
my femra's eyes felt weird so i took them out and maybe im starting to regret that
>>
>>562982779
>aryan
>he said ARYAN
LOL
>>
File: 1764514922877253.jpg (418 KB, 1574x970)
418 KB
418 KB JPG
>GANiggcess taking all the (you)s that my flux using femlala used to get.
me femlala hate this.
>>
>>562982746
craziest logic on display here
>>
Queueing for CC = Consent
>>
>>562982875
drg or smn, depending on my mood
>>
File: 1758329242127210.png (170 KB, 736x760)
170 KB
170 KB PNG
>>562982779
>>
>>562982779
>post your dna sequence
disingenuous request but honestly i'd consider it if i thought for a second you'd honor your challenge and i'd never have to see your awful jeetbrained posts again
>>
you want a good girl
but you need the bad sissy
>>
File: file.png (112 KB, 750x719)
112 KB
112 KB PNG
>>562975871
My mooner got this
>>
I genuinely think Family Guy is funny.
>>
>>562982957
queue up bro lettuce suffer together
>>
>>562976197
I really have to get this off my chest but there's so much off with this one image
I usually love buff chicks but some about the lighting and whatever texture they used for the skin makes her look ill.
Don't get me started on her abs, they're so defined to the point of looking like a water balloon stretched across a grate.
Now maybe it's just the lighting or whatever but around her naval may be a tattoo but I assume the discoloration is blood flow(?)
Positives though I'd that this Swys looks pretty, outside of the pose she's probably hot, and the outfit is nice... Just that the rest of it looks horrid.
In conclusion I'd let her crush me
>>
there's nothing worse than a fat tranny
>>
>>562982935
>I AM BLOODY ARYAN SAAAAAAR I AM ARYAN
>>
>>562981997
who is the "large lady"? We must think... Bigger..
>>
>>562982438
I got you
https://www.xivmodarchive.com/modid/80362
>>
>>562983035
a fat balding tranny
>>
>Chloe Scarlet "depressed" again
Does this bitch every have a good day?
>>
>>562983035
I dunno. I think taxes are pretty terrible but that’s another thing entirely
>>
>GAMcess
>Pawgcess
>He/him pawg
>GANiggcess
I am never leaving this general.
I was in a bad mood but now I'm not.
Thanks /xivg/
>>
>>562982385
every time I see this pose I remember Riallant calling you a little faggot with almost that exact same screenshot
>>
Playing GNB in cc = consent
>>
>>562983106
no lol
i stopped talking to him because he was pretty much always a miserable fuck in private
>>
File: Spoiler Image (17 KB, 115x96)
17 KB
17 KB PNG
>>
>>562979906
>the most annoying faggots all lined up
I feel bad for alter having all these retards hover over their FC
>>
my BPD score was kinda high so I'm not gonna post it with my character so people don't know to avoid me
>>
>>562983149
>I remember Riallant calling you a little faggot
Ironic considering his tastes in trannies.
>>
File: 1751620905781166.png (55 KB, 536x403)
55 KB
55 KB PNG
>>562975871
My [REDACTED] got hurt by a 100% recently.
>>
>>562982779
>post your dna sequence
here's a sample i guess
ATGCTAGCTAGGCTTACGATCGATCGTAGCTAGCTAGGCTAGCTAGCTAGCTAGCTAGGCTACGATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAACGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
>>
imagine telling other people how you feel
>>
>prove you’re whiter than me
>”thats disingenuous”
Lmfao
>>
>>562983232
it has pretty much never worked out for me, yeah
>>
File: 1752944474542417.jpg (883 KB, 2560x1440)
883 KB
883 KB JPG
me dogboy is aryan and sent the dogger race to reduce the quality of this board
>>
>>562983141
>good king moogle mog
>he/him pawg
this one always gets me
>>
my moonie basically invented sauerkraut
>>
>>562979906
thats a lot of cheaters and incompetent players in 1 picture
>>
>>562983227
cloning this anon to be my underdesk suckpet
>>
>>562983185
Which one are you
>>
Imagine feeling
>>
*coughs up blood* j-join my m10s clear pf on aether,,,, blease,,,,,,,,,,
>>
>>562975871
I did so well!
>>
File: 23.png (3.21 MB, 1057x1418)
3.21 MB
3.21 MB PNG
>>562975557
lalafell
finally done with the pvp grind
>>
my fiddie is kind of tired of it.everything.
>>
File: The thread elite bins.png (1.62 MB, 1242x694)
1.62 MB
1.62 MB PNG
>>562982469
Queen Appal can you ask Lord Heiko when are we going to move to a new spot? Because the current spot is a big yikes from me. Too many non-ebins messing up the vibes, especially when we all come to 4chan for a comfy and eepy wholesome time. We need to cleanse the ranks of lowly filth by bringing the spot somewhere secret. No alts, no thread peasants, and most importantly, no one that’s not in the ‘cord with us.
>>
Imagine being a sentient being
>>
>>562983206
Yep. Common BPDemon behavior. Hiding their shit traits then turn the life of someone innocent into hell.
>>
>>562983261
Just say you don't know what a DNA sequence is, saar.
>>
>>562983261
no, expecting me to post DNA results on 4chan and expecting both of us to do so honestly is disingenuous
believe me if i had a real verifiable shot at wiping ai kotoba off the board forever i'd take it but this ain't it
>>
>>562983272
>boy
>female character
loser
>>
>>562983357
>Sentient
FUCK OFF BACK TO TAU MOTHERFUCKERS
>>
>>562983338
thanks, female otis.
>>
>>562981807
Why would I name her Quick, that sounds as dumb as naming her Soft Doll or something
>>
>My Tomestone and FFlogs gets updated by someone every week
>>
>>562983341
i'm about one inconvenience more away from blowing my shit shmoove off at any given time
>>
>>562983347
i cannot ever take kawaiitely serious again after learning he not only is into sph but also chastity cages
>>
>>562983361
I don't think I've hurt anyone... if anything they hurt me... and I let them...
>>
I just realized, when people here say "fakenice", do they mean being POLITE?
Yeah I don't shit talk you in public man, that's called being polite! Even if you don't say it out loud, you've probably thought someone was annoying or rubbed you the wrong way once!
>>
>>562983347
do ANY of these sewer skinks like femezen? O_O
>>
>>562982095
Get down Mrs. Mooniedent
https://files.catbox.moe/ts48qr.jpg
>>
taking an obvious exaggeration as a serious request simply because you have a hateboner for the grown ass man who posted it is hilarious
>>
>>562983341
What's wrong?
>>
>>562983445
is it me
>>
>>562983445
both me
i don't want to schizo you, I just like knowing how you're doing
>>
>>562983341
same sis
idk why I even log in anymore I hate the game and most of the time the people I call friends
>>
>>562980760
What's galter? Did they make a 4th alter?
>>
>>562983218
DB you proudly admit you want to suck H'ana's cock and you actively are more interested in his male character than his females
>>
I didn't catch either of the ocean legends, might kill myself
>>
>>562983398
*adapts to your hate*
Nothing personal fleshbag
>>
>>562983292
just because your moonie put her cabbage and bag of salt in the same bag so she wouldn't lose them and then forgot about itdoesnt mean she invented saeurkraut
>>
>>562983434
i know soft doll lol
>>
this grown ass nigga just ejaculated all over his phone
>>
File: ffxiv_dx11_cMgM04psX5.jpg (32 KB, 477x288)
32 KB
32 KB JPG
woo
>>
File: file.png (49 KB, 724x531)
49 KB
49 KB PNG
>>562975871
My femra is uhh..... not surprised by this
>>
>>562982938
Sounds like you need to show more butt.
>>
>>562983579
I'm sorry to hear that, I hope she gets better soon
>>
>>562983460
wha'ts wrong with that?
>>
>the jeet who asked himself for an "Album?" without realizing there were thread IDs is now "anonymously" vagueposting in his own defense
at least you're consistent, saar
>>
>>562982584
>cishet
nigga u ask to see cocks almost everyday
>>
>>562981050
>Join us!
I did, I'm just not a catboy so you didn't notice
>>
>>562983491
Now we're playing victim... Not looking good for you.
>>
>>562983398
Do you think Caliban is like a hapa chud? Would he post on r/TauMalePride?
>>
>>562983663
qrd?
>>
>>562983525
my retainer has been renting out my house as an air bnb and putting all of the overhead costs on my credit card
>>
File: 1746525244997534.png (260 KB, 235x765)
260 KB
260 KB PNG
>>562983347
oh shit thats me
>>
>>562983663
did that actually happen LOL
>>
Men are only picky when
>A: a race/gender completely fall out of their tastes (No lalas, no men, etc)
>B: they are virtue signaling for their own clut (femra cult, lala cult, etc)
Otherwise IRL men will potentially fuck anyone outside those two situations

Bioholes are the only ones who are genuinely racist.
>>
File: Untitled.png (66 KB, 534x315)
66 KB
66 KB PNG
>>562975871
Good job self
>>
>>562983663
>take someone's picture
>post it
>reply to it
Why are the schizos so lazy and boring today
>>
File: file.png (675 KB, 541x880)
675 KB
675 KB PNG
>>562983417
np
>>
>>562983496
5 out of 6 of them are transsexual futa players and the 6th quit the game.
>>
>>562983495
There are a lot of autistic people here.
>>
File: 1747793941817512.png (1.02 MB, 736x981)
1.02 MB
1.02 MB PNG
12:40 CC ET Crystal
>>
>>562983681
I'm sorry... please forgive me... if I hurt you I never meant it and it hurt me so much more than you can imagine...
>>
>>562983569
yes it does
>>
>>562983498
I gotta stop clicking random catboxes
>>
only schizos take that test btw
gz on outing yourself
>>
>>562983718
>>562983750
it was a falseflag
>>
I wouldn’t fuck an Indian woman
>>
>>562975557
Hell yea
>>562975871
I swear it's just 3 different comorbid conditions and countless shitty social situations growing up giving me brain damage. I hope, at least...
>>
File: 03647802341287346.png (2.01 MB, 1679x994)
2.01 MB
2.01 MB PNG
>>562975871
Ughhh I failed the test
How am i supposed to be a bad bitch without bpd? Is it over for me?
>>
>>562982860
>Is this a femezen
Sorry, midlander male. The mask would be for the other character in the pose (and I don't currently have any femezen lined up).
>>562983102
Ha! Completely different vibe from what I was going for, but I might keep that handy as a silly gag.
>>
>>562983149
why do you think he copied it and has been melting about melf, his brain was COLONIZED
>>
File: 1.png (73 KB, 787x711)
73 KB
73 KB PNG
>>562975871
normalfag sisters...
>>
File: 1770784819044771.png (1.85 MB, 1111x1132)
1.85 MB
1.85 MB PNG
>>562983913
That's not good, you seemed more normal.
>>
>>562983838
oh ok
>>
imagine if we had IDs
>>
File: file.png (111 KB, 734x708)
111 KB
111 KB PNG
Deadass i'm normal?
>>
>>562983783
>>562983876
they tried to do the same to Appal with the "Cute fish" thing
>>
What's with all the fake low results?
You're on 4chan, you are NOT that secure and emotionally stable
>>
imagine if we had country flags
>>
i could never marry a femra i would end up accidentally smothering her to death with affection
maybe its for the best
>>
>>562983989
Nigga he larps as a fat chud, do you really think that’s normal
>>
>>562984024
Korra...
>>
Imagine if I had you…
>>
File: 1754985234878141.jpg (82 KB, 720x720)
82 KB
82 KB JPG
>the fat trans vampire lala seemed "normal"
>>
>>562984006
it'd literally be one schizo replying with anything and to anyone with 120 out of 800 posts like it happened on the other site
>>
>>562983876
he's just replying to himself
>>
>>562983913
Which ebin is insane enough to crack bling bling boy over here.
>>
i hate going on primal for meetups its dangerous on that data center
>>
im feeling really gay guys
>>
>>562984062
>>562984097
"he" is FtM too btw you know in case you needed even more?
>>
>>562983218
You have stalked, sexpested, and melted about every tranny in here, as far as I remember all he did was say he doesn't hate trannies
>>
File: file.png (1 MB, 906x718)
1 MB
1 MB PNG
>>562975557

>>562975871
quack test tbdesu
>>
>>562984037
I took the test multiple times and posted the result I was happy with.
>>
>>562983798
Well, yeah, I know where we are, but like, I thought that was just common sense!
>>
File: 1756457024465681.png (413 KB, 612x380)
413 KB
413 KB PNG
>>562984081
>>
>>562984037
>tsch I go on 4chan, I'm emotionally dark and twisted like Shadow the Hedgehog heh
>>
nobody wants a fiddie that scored a 50
>>
>>562984074
we are all deadass inclusive of gay, straight, bi, lesbian, trans, all walks of life here doe
>>
>>562984192
Time to dick him down so well he turns back into a woman
>>
>>562984248
You're not getting a fucking 0% on the test bro this insecure reply is literally proof of it
Try again and be honest this time
>>
>>562984037
I have used this site for far too long and have been considered a normie by many anons at this point
>>
>>562983826
Freak.
>>
>>562984037
I’m here because I’ve been here for almost 20 years, not because I’m maladjusted.
>>
File: 1747106520161657.png (2.48 MB, 1080x1920)
2.48 MB
2.48 MB PNG
>>562983010
sounds like someone is scared !
>>562983227
my moonies looks like GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT
>>562983498
thank you for your service
>>
will my femra find love today on balmung?
evens yes
odds no
zero she gets raped and murdered
>>
>>562983460
sounds pretty based tbqdesu
>>
>>562984375
Gross!
>>
>>562984379
can we make it a zero anyways
>>
>>562984349
I don't remember writing this
>>
>>562983767
this femlala looks like she's very talented
>>
>>562984379
lol stupid chudra, you leave balmung if you want to find love
>>
>>562984375
this moonie would look based tied up!
>>
>>562984353
I think it's weirder not to feel this way... everyone is so cruel and emotionless... like zombies... I bet you take SSRIs...
>>
>>562982168
I'll try keeping the lalas closer to the image given.
https://files.catbox.moe/70lbcd.png
>>
>>562984446
i'll reroll it but I only have 1 command point
>>
>>562983106
why is romani leaking private conversations?
>>
File: 1746679518465504.png (666 KB, 865x656)
666 KB
666 KB PNG
>>562975871
ironic considering i was diagnosed as a teen
>>
File: 1760089453341897.jpg (3.19 MB, 2876x2156)
3.19 MB
3.19 MB JPG
>>562975871
i'm emotionally dark and twisted like shadow the hedghehog heh
>>
File: 4985943345.png (184 KB, 1025x531)
184 KB
184 KB PNG
>>562975871
Neat :)
>>
File: 1751991206145155.png (3.83 MB, 1744x1499)
3.83 MB
3.83 MB PNG
>>562984541
Well, it's not an accurate test.
>>
>>562984453
Anons cannot comprehend it sometimes, there's just something about shitposting that I'll never be able to kick the habit I know that in my bones
>>
>>562983498
>No one has tributed my femra yet
fuck my chudra life
>>
Is the bloonie still here? I want to talk to you for a second.
>>
>>562984548
+?
>>
File: 1750966858289203.png (2.73 MB, 1920x1080)
2.73 MB
2.73 MB PNG
>>562975871
>>
>>562984341
what are you even trying to prove?
that deep down everyone is as ugly as you?
>>
>>562984341
Nta but I got a 0%
>>
>>562984248
Shadow the hedgehog's actually one of the most mentally/emotionally grounded characters in the franchise past his introduction and gun game
>>
will my fiddie find love today on balmung?
evens yes
odds no
zero she gets sexpested by annoying people
>>
>>562984548
does she like fiddies
>>
>>562984548
saw this rabbit not wearing underwear in public the other day...
>>
>>562984548
I deadass can handle the huzz

>>562984212
twinem! ty for serif mod shi go brazy
>>
>>562981658
t4t
>>
File: 1771146241696953.jpg (207 KB, 1920x816)
207 KB
207 KB JPG
>>562984234
don't let this schizobabble distract you from the fact that Hector Hectorson is going to be running three femras, with mirapri glams. And on top of that, he just went into XMA's discord, and he comissioned three custom facesculpts, with MAKEUP, and a tail mod.
>>
File: file.png (592 KB, 512x532)
592 KB
592 KB PNG
>>562984675
>twinem! ty for serif mod shi go brazy
u got it wrong again bwo...
>>
File: apprehensiveblep.png (1.98 MB, 1080x1440)
1.98 MB
1.98 MB PNG
>>562984608
Do ya mean me? or a different one
>>
>>562984647
it's utterly over.
>>
>>562984375
Your moonie is more like MOOOOOOOOOOOOOOOOOOOOO
>>
BPD aint real you're just an asshole
>>
>>562984735
bru, oh wait Saran twinem got da femrala fr fr
>>
>>562984779
Yeah! You're into Blender, right?
>>
>>562975871
Here we go!
>>
>>562984601
It's just fun, there's really no other place like 4Chan
>>
>>562984885
you like lalas now? lmao
>>
>>562984595
WIFE.
>>
>>562984541
I diagnose you with wife
>>
File: 1764322522537642.png (82 KB, 768x653)
82 KB
82 KB PNG
>>562975871
my fiddie is incredibly well adjusted
>>
File: 1747079120893887.jpg (156 KB, 864x1080)
156 KB
156 KB JPG
My wife.
>>
>>562984687
The fact that “f+”’s don’t consider their characters trans is just the last in a long line of baffling delusions held by futards.
>>
File: file.png (3.07 MB, 1204x1241)
3.07 MB
3.07 MB PNG
>>562984885
i got two i got the blonde and the brun
shan's got the shantotto lala
>>
>>562981940
yeah, he's great...
>>
File: 1775070740162808.png (417 KB, 500x548)
417 KB
417 KB PNG
>the actual schizos all get 0%
>>
>>562984906
the prettiest moonie
>>
>>562983913
disgusting shapeless michelin man legs
>>
>>562976816
give us some screenshots cuh
>>
>>562985036
they both ended up with these looks after pandaemonium but they werent talking do we believe it
>>
The fight itself was lame, but the music made me want to start skanking and bringing out my checker pattern belt.
>>
>>562984507
I like the annoyed expression
>>
File: 1768170601087930.jpg (1.02 MB, 2202x2241)
1.02 MB
1.02 MB JPG
https://files.catbox.moe/owizue.mp4
>>
File: 1775266046304966.png (471 KB, 1000x1000)
471 KB
471 KB PNG
We should bring up the 16 personalites test again so I can laugh at how many introverts there are in Final Fantasy XIV: Dawntrail
>>
>>562984375
Thanks for your moonies
>>
File: file.png (90 KB, 335x284)
90 KB
90 KB PNG
>>562985109
if you
caaaaaan
believe it
that's exactly what happened
>>
File: 1761717778581202.png (2.35 MB, 1486x1435)
2.35 MB
2.35 MB PNG
>>562975871
yeah
>>
>>562985054
real knowers know that ones with higher scores are more than likely foids
>>
>>562984962
What?

>>562985036
wait have i been speaking to saran this entire time... i'm sorry twinem...
>>
>>562982584
is it true you ask to see cocks everyday?
>>
File: 20260331_113219.jpg (21 KB, 601x532)
21 KB
21 KB JPG
>>562984973
Yippeee! its gotta be autism.
>>
>>562984905
I'm nyot the most knowledgable on it if that's what you're asking but I can try to answer whatever you're asking. You might be better off putting that question somewhere else mind!
>>562984952
So true man
>>
>>562985267
Boring.
>>
>>562985054
>pick the normal answers
>get 0%
r u srsly surprised?
>>
>>562985171
Kino
>>
>>562983291
Same. Now everytime I get moogle king mog in a trial roulette, this will pop in my head
>>
>Rue
Dropped.

Wrong pawprint retard.
>>
If you post 0% on the BPD test I'm unironically wary of you and probably going to avoid you since it means you don't really experience human emotions and you're probably going to shit talk or even schizo me behind my back
>>
>>562985267
PEAK
>>
>>562983913
Your characters are funny but everything you share about the pilot makes you seem like a deeply unpleasant person.
>>
File: 176987386367282.png (27 KB, 120x116)
27 KB
27 KB PNG
>>562984906
this looks retarded
>>
>>562985171
>not aislop
WTF
>>
please don't use the term "suckpet".......
>>
>>562985267
HOLY FUCKING SHITTTTTTT!!!!!!!!!!!!!!

>>562985259
Futacock is DIFFERENT ON MY MOMMA!!!!!!!!!!!
>>
File: 1763583902859200.png (1.53 MB, 843x1245)
1.53 MB
1.53 MB PNG
>>
File: 1771986877399630.png (634 KB, 1524x690)
634 KB
634 KB PNG
>>562975871
you people are freaks
>>
>>562985267
Janny is gonna FREAK
>>
File: 1750565746037948.png (295 KB, 630x630)
295 KB
295 KB PNG
6:40 CC ET Crystal
>>
>>562985374
How so, schizo-kun?
>>
>>562985324
This nigga loves bbc
>>
File: file.png (9 KB, 241x61)
9 KB
9 KB PNG
>>562985240
can u rly not tell us apart bwo...
>>562985340
u dropped these
>>562985346
its fucking over
>>
okay then SUCKSLAVE
>>
File: paw1-696883034.gif (41 KB, 314x475)
41 KB
41 KB GIF
>devs listen to the thread for suggestions for stuff to add to the game
>one of them will be randomly selected like the housing lottery

What do you suggest to be added to the game?
>>
>>562982746
If this was actually wookie, it's brutal lmao
>>
>>562985389
If you'd just said, "her eyes are not looking at the camera" you wouldn't have given yourself away.
>>
File: 1751110722580925.png (367 KB, 560x434)
367 KB
367 KB PNG
>>562985456
>>
File: 1354343423.png (974 KB, 1000x1084)
974 KB
974 KB PNG
>>562975871
what ever stupid test anyways
>>
>>562985487
I've talked to a bunch of the 0%s actually and they have like... literally no empathy at all
Completely self absorbed people who don't even view you as a person
>>
>>562985447
ok vacuumra, get to work

*hands you a maid outfit and a house vacuum*
>>
>>562985267
really cute actually
>>
>>562985267
does she like middies
>>
>>562984603
Face 1 or 4 femra post
>>
>>562985557
given what away, i think the mouth looks ridiculous in that emote too
>>
>>562985171
Fiddie run looks so damn good on femra
>>
>>562985452
>Futacock is DIFFERENT ON MY MOMMA!!!!!!!!!!!
faggot in denial
>>
>>562985510
playable lowlanders DUUUUUHHHH
>>
>>562985487
no no, I can! with da femras fr fr... I just be forgetting who is who wit da small jits... I'm sorry twinem...
>>
File: 1767133391213517.png (2.36 MB, 1135x1431)
2.36 MB
2.36 MB PNG
>>562985559
>>
Is this game tricking me into fighting Ocelot, but as a duskie?
>>
>>562985171
Never forget that halmarut invented morbols
>>
File: oh shit new gate.jpg (253 KB, 938x994)
253 KB
253 KB JPG
>>562975871
>>
File: 1758470201467366.jpg (356 KB, 2058x2383)
356 KB
356 KB JPG
i'm glad xivg has moved beyond the "celebrate their mental illness by maximizing their mental illness scores on shitty internet mental illness tests" phase
>>
>>562985510
Complete combat overhaul to be more like TERA
>>
File: ffxiv_04082026_134414_848.jpg (641 KB, 1920x1080)
641 KB
641 KB JPG
>>562975871
why the fuck is the queue so long for rw
>>
>>562985668
cute glam
cute femra
lovely smilke
this one's a 10
>>
>>562985648
Femra are just fiddies but better
>>
>>562985664
type normally or shut the fuck up.
>>
>>562985317
May I PM you? Just going to ask you something, sorry if this is ultra sus.
>>
File: 1760086803655994.png (1.29 MB, 858x1132)
1.29 MB
1.29 MB PNG
>>562985559
>>562985668

>>562985752
She's a mom.
>>
File: erm.png (384 KB, 756x575)
384 KB
384 KB PNG
>>562975871
is this right?
>>
>>562985706
wait are we maximizing or minimizing the scores now?
>>
>>562985746
Can your lalaboy eb's schmeat get past your cheeks?
>>
>shit mood cuz of cc
>feel better after taking a walk
>play another game and its instant depression again
maybe i am bpd
>>
>>562985808
Sure, I'm online right now on lich
>>
>>
>>562985510
Make CC the only PvP mode
>>
>>562978589
turmeric stained hands wrote this post
>>
>>562985746
why does your lalaboy dress like a whore
>>
>>562983498
>she barely responds
bro...
>>
>>562985812
Moms need love too
are you looking for a father? I'll teach you how to play ball
>>
>>562985861
Alright, give me a min!
>>
>>562985864
Is this real?
>>
>>562985856
i think you just needed some sun and still need some sun
>>
>>562985861
Light!
>>
File: 9lsd.jpg (162 KB, 1920x1080)
162 KB
162 KB JPG
>>562985797
Uh oh, schizo meltie
>>
>>562985864
>femra gook slop
SOULLESS C-C-C-C-COMBO
>>
File: file.png (8 KB, 198x48)
8 KB
8 KB PNG
>>562985510
an unironic social link deal tied to trusts where the more story-relevant npcs like you the more likely you'll see them in the overworld during your adventures like prishe/alxaal or alpha/omega. it'd be nice to see the scions candidly doing things around the world like thancred on a "mission" to hit on some dancer or estinien getting ripped off again in one of the major city's trading hubs, and their dialogues when you talk to them would change based on how close you were. maybe they can even give you dyes, gifts, trinkets and unique little cosmetics for fun based on who they are.

they're your close teammates, give us the ability to make it feel that way.
>>562985579
now that you mention it yeah i can kinda get it. im personally a little avoidant, although i wouldn't say i don't see people as people, just kinda a machine going through the motions after a certain point.
>>562985664
its OVER
>>
File: ffxiv_03192026_185815_295.png (1.57 MB, 1663x1009)
1.57 MB
1.57 MB PNG
>>562983989
I'm usually extremely calm, maybe a bit energetic, I'm just retarded and struggle to read social situations on top of a few other frustrating traits to people. I'm better than I used to be thankfully.
>>562984310
For many reasons this wouldn't happen.
>>562985374
Care to explain how? Genuinely curious. I don't want to be unpleasant, but I've come to realize my personality is like oil to many's water.
>>
>>562985954
npnp, if I'm slow to reply it's cus I'm doing fates as blu
>>562985969
Home..
>>
File: 1749150015629328.png (885 KB, 1472x1386)
885 KB
885 KB PNG
>>562985945
Nigga. It's a golem.
>>
>>562985740
if I could snap my fingers and make it perfect then I think this is the number one

I know people that were endlessly enslaved to that game purely because of the combat, and the only one friend I know that played both(Kirsche who still uses her Elin as her vtuber avatar) still misses it(but not the publisher bullshit lol)
>>
>>562985835
yeah

>>562985886
it's hot, don't need another reason.
>>
>>562986057
you definitely need a father figure
>>
>>
long passionate makeout sessions with meiwo
>>
I have melee dps anxiety
>>
>>562975871
>>
File: 1774740587687376.png (1.61 MB, 1228x1431)
1.61 MB
1.61 MB PNG
>>562986165
Dude I'm 24 and own my place.
>>
>>562985494
STOP
>>
>>562986146
>(Kirsche who still uses her Elin as her vtuber avatar) still misses it(but not the publisher bullshit lol)
parasocial shit nobody asked about
>>
>>562986043
I want to make you feel like a MAN, Batz
>>
>>562986182
Meiwo and Ai
>>
>>562986234
i'm giving an example of somebody that loved the game so much that they took their character and made it their entire business-facing personality
>>
>>562985267
What band-aid?
>>
>>562986180
ah hell no they modding fiddies and femra into re6 menus
>>
>>562986324
It's aislop
>>
>>562986043
are you actually ftm? do you look like a faggot irl? as long as you don't strip skin from your thigh to form a fake penis made of thigh skin or overdose on testosterone to give yourself norwood 5 i'll be your "friend"
>>
>>562975871
I got a 0, I demand a reward.
>>
>>562986234
My femlala wants to know more about kirche or whatever it is Berke-sama is talking about…
>>
>>562986279
At the same damn time.
>>
>>562986218
what you mean is that you pay rent in washing dishes and your mom owns the place.
>>
File: 2025-12-14_19-06.png (1.87 MB, 1920x1080)
1.87 MB
1.87 MB PNG
I'm logging in
>>
>>562985694
>Never forget that halmarut invented morbols
just gonna make it better when i feed her to one in my next Hairymutt scene.
>>
File: file.png (77 KB, 781x530)
77 KB
77 KB PNG
I really am the most average person in the world
>>
>>562986387
No one gets mad at you for being the way you are.
>>
>>562986410
FOR MY NIGCODED LALABVLL STUD
Wait a second.
>>
>>562985706
No one does that, most internet tests are just terrible and tell you you're mentally ill because they were made by tumblerites who think "getting mad occasionally" means it's okay to get unreasonably mad for no reason because you have some self-diagnosed mental disorder.
>>
>>562986405
giga racist rightwing grifter
https://virtualyoutuber.fandom.com/wiki/Kirsche
>>
>>562986430
are you the malezen who always has his cock out?
if so im a big fan of yours
>>
>>562986426
Nah I haven't spoken to family in five years. I completely cut them off after I ran away from home when I was 19.
>>
>>562985510
rival wings roulette
>>
getting a 0 shows you specifically those the "right" answers btw instead of answering truthfully
so you are indeed a bdpdemon
>>
>>562985927
What response is there supposed to be? Moonies expect cum on or in them. It isn't even a video.
>>
>>562986319
NTA but https://xivmodarchive.com/modid/129600
>>
>>562985510
hairstyles on glam plates
>>
File: 1773783001993782.png (153 KB, 273x283)
153 KB
153 KB PNG
>>562986471
>no one does that
>>
>>562986490
https://www.reddit.com/r/VirtualYoutubers/comments/1kblbdw/a_serious_discussion_about_kirsche_verstahl_and/
damn I didn't know berke had based taste in vtubers
>>
>>562986465
There can't be two of us in the thread.
>>
File: 5404774669_569f85b332_b.jpg (148 KB, 1024x817)
148 KB
148 KB JPG
>>562986490
>giga racist rightwing
Based.
>>
>>562986567
Uh oh BPDemon melty
>>
Alright enough laughing chucklefucks, make a new fucking thread.
>>
>>562986567
>seething that your thread enemy was actually mentally sound unlike you
heh
>>
File: 1756026336774864.jpg (186 KB, 1920x800)
186 KB
186 KB JPG
i hid the mental illness anchor
>>
>>562986490
she fucks black men tho
>>
>>562985510
a proper dump vault so my inventories aren't constantly full and I don't have to pay real money for more retainers to store more stuff.
>>
are femra into ntr
>>
what is it with biofems and personality tests?
>>
>>562986016
im sorry twin... im really really sorry...
>>
>>562986535
this but unironically
we have 2 FL maps going on at the same time and it works fine, so why not YoshiP
add it add it add it add it add it
>>
>>562986772
Yeah they said racist
>>
>>562986772
what's up with you following berke around and posting about blacked constantly? do you have something you want to confess?
>>
File: 1755533318393027.mp4 (1.41 MB, 720x658)
1.41 MB
1.41 MB MP4
>>
>>562986016
you're not the 0%, that comment was about korra being loaded
>>
>>562986741
>doing this
Good job!
>feeling the need to announce you did
Miss!
>>
File: PT.png (166 KB, 1080x1117)
166 KB
166 KB PNG
>>562975871
I live in the thread endlessly post about parses for thread enemy ebins
>>
did not take the BP test because I already know the results

it does good
>>
>>562986529
you're online eighteen hours a day, nobody asked for your character's backstory, we're talking about you in real life living in your momma's basement melting about trannies turning you down
>>
im... taking my meds........
>>
File: 1767227060385932.gif (855 KB, 400x300)
855 KB
855 KB GIF
>>562986892
>>
File: h5h56d.jpg (1.65 MB, 2540x1440)
1.65 MB
1.65 MB JPG
>>562975871
me hrothgal actually isn't that crazy she just has extreme bouts of low self-esteem and pessimist thoughts sometimes
>>
>>562986845
I don't care about Berke
Kirsche has talked about her love for BBC multiple times on stream and you chuds should know that before you start simping for her as "le based right wing foid"
>>
Fine, I'll do it myself.

>>562986931
>>562986931
>>562986931
>>562986931
>>562986931
>>
>>562986930
please keep your fetish to yourself
>>
>>562986930
uhm im a trump voter and blacked is based
women deserve to be fucked by animals
>>
File: 1770831786114837.jpg (516 KB, 1080x1920)
516 KB
516 KB JPG
hmm...
>>562986567
I responded 100% truthfully including some stuff that would probably flag but idk maybe the things that are not bpd just knocks the score down to the negatives and the lowest it shows is 0%
>>
File: 1754151722074275.png (76 KB, 770x528)
76 KB
76 KB PNG
>>562975871
what a dumb test it doesn't mean anything
>>
>WOAH IS THAT A FEMALE AU RA IN THE STORY WITH GREEN SCALES WHO SAID A FEW AMBIGUOUS LINES
>DESPITE NOT HAVING A TIMID PERSONALITY I ASSIGNED IT TO HER AND DIDNT LISTEN TO ANYTHING IN THE CUTSCENE SHE WAS IN
>>
>>562984987
>>562985171
>>562986849
I really hope they make her more autistic than grace ashcroft
>>
File: 1767625553916575.jpg (351 KB, 2421x1361)
351 KB
351 KB JPG
>>562975871
am i too late?
>>
>>562987047
shut up bitch
>>
File: siigh.jpg (599 KB, 1215x914)
599 KB
599 KB JPG
>>562986535
i honestly gave up they'll ever do anything meaningful with rw ever.
>>
>>562987149
WUK LAMAT 2 IS WIFE
>>
>>562987047
She literally pisses her pants upon seeing (You)
>>
>>562987234
She just says some random shit about the witherers and then hides from you. Which doesn't mean much considering you also fucked up the person she's with. She's not even in like 10 minutes of cutscenes to have a personality yet I wouldn't say she's some timid nerd girl.
>>
>>562984375
Sexiest moonoid here ngl
>>
>>562987147
this is a cute fiddie
hello ma'am can you show me where the nonfiction books on rocks are...
>>
>>562984976
im not wife material
>>
File: ffxiv_04082026_171040_553.jpg (963 KB, 1920x1080)
963 KB
963 KB JPG
RIDING SIDE BY SIDE UNTIL WE DIE



[Advertise on 4chan]

Delete Post: [File Only] Style:
[Disable Mobile View / Use Desktop Site]

[Enable Mobile View / Use Mobile Site]

All trademarks and copyrights on this page are owned by their respective parties. Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.