Uuh fuck off bullies..>Moogle Treasure Trove - (March 31st -> April 28)https://na.finalfantasyxiv.com/lodestone/special/mogmog-collection/202603/lba1j4i815>Patch 7.45 Noteshttps://na.finalfantasyxiv.com/lodestone/topics/detail/2e8a10c44121af50ce86e1b605e10608e15f24d6>Resourceshttps://rentry.org/xivgresources>Meetups• April 8, 9:00 PM EST | Primal, Famfrit, Lavender Beds W15 P20 | Spooky Club: Gaki no Tsukai >>562655897 • April 10, 10:00 PM EDT | Crystal, Mateus | Casual Queue Murder Meet >>562478015 • April 17, 4:00 AM PDT | Sophia, Materia | Eulmore, The Beehive | Live Letter Meetup >>562390635 • April 25, 10:00 PM EDT | Dynamis, Cuchulainn | Empyreum W27 P52 | RP Speedmeeting >>562561983 Previously: >>562964373
Hey post some lalas
my galter character will be attending the cc meet whether you like it or not
• April 10, 10:00 PM EDT | Crystal, Mateus | Casual Queue Murder Meet >>562478015 • April 13, 8:00 PM EDT | Primal, Exodus | Empyreum, Ward 26 Plot 34 | Homestuck Meetup >>562681351• April 19, 4:00 PM CEST | Light, Lich, Empyreum, W7 P48 | Frenchra movie: Pulp Fiction >>561912764 • April 25, 9:00 PM EDT | Dynamis, Cuchulainn | Empyreum W26 P51 Molly Bloom Orgy Meet >>562656776
i ama gay lalaboy
someone bring out the borderline personality test anchor
>>562975530no one knows or cares what your numbers mean you babbling retard
My moonie is freshly cleaned and ready to rock
>>562975571im pretty sure, but also im borderline enough to not post it if i got a high score
>>562975389My logs are literally more real than yours though? And I don't log my fights since I first cleared M11S in Jan twin. You can parse my nuts though
>>562975530I don't press Feint, you gonna schitzo me next?
>>562975571My moonie is very mild
>korra is insecure about his parseslollmao
we get it already korra got 7 damage downs and none of us care schizo
Dude we love out ankh'd ebin!
Is my schizo +?
>>562975664i can't imagine hanging around here when you have a girlfriend and obviously enough money to kinda do whatever the fuck you want
Every time I get schizoed I bounce on it harder
>>562975571my maliddie is posting it DESPITE my directionshttps://www.idrlabs.com/borderline-personality/test.php
>>562975812im not your schizo but im
They saying 5’4 the new 6’0!!!!
>ZT
guys are really getting into astronomy to find THAT femra
when korra clears m12 with the huzz schizo gonna rope LOL
>>562975786>out
>>562975835I been phoneposting whenever I'm working and when I'm at the gym :3 why you pocketwatching
>>562975786I'd love her if you know what I mean
SEX WITH MOONIES!!!!!!!!!!!!!!!!!!
You like?
>>562975835you really think hes telling the truth? lolhe was lying for a month about people wiping his M11s pulls but then some schizo found the logs and it was all him
>>562975976Leave my moonie alone goddamnit
my femra has INFINITE power and could end all life everywhere across the entire universe with a snap of her fingersthe only reason she doesn't is because you're cute
>>562975925LMAOO twin ily
>>562975918I've been interested in astronomy for a long time, just not smart enough and/or disciplined enough to get into the field. But also big femra sexo
>>562976026I hope this is the femra I'm thinking of
>>562976015No come here!!!
we need more lowlanders
>>562976026thank you femra i will remember your mercy...
>>562976142Aiieeee
>>562975980>he's been spamming this all day as if anyone cares
>>562976187*eats you*
>>562975891LEMME SEE TWIN!!!!!!
>>562976026>infinite power>only influencing a single universeMy loli OC could erase you with ease as well as the entire omniverse if she so willed it
thanks if u joined (i didnt win any gear)(i also died to vamp stomp 3 times because im bad at the video game))ps. join my ia2 to clear m10s pf blease
MALE MIDLANDERS?!?!?!??!??!
>>562976026my femra is a void, nothing, her soul is a black whirlpool circling round nothing
>>562976298and yet she still ends up with my dick in her mouth, curious
>>562970484bruh
>>562976207p-please...
>>562976026my femra is immune to your femra because her existence is bound to forces beyond the boundaries.
>>562976269why do you want to see penis so bad
>>562976159
your moonie is on my rape list
>>562976350Only her futa little sister's actually
>>562976370Nyoo my moonie doesn't do that, you'll have to find one that does!
>>562976026y-you too sis....
>>562976426Forget the list, she goes to the block.
>>562975530It's the healer faultthey should have put their mit downand crit their shieldAlways the healersI wish SE deleted healers
>>562976440yeah that's me
>>562976090>
>>562976420God I love femroes so much it’s unreal
I saw all of your guys' posts./pet/mdance
Gonna take a break from calls because I hate C9 and will cotinue calls after Cl*ud nine is over
>>562976264aieeeeeee
>>562976513looks kinda greasy
>>562976380I like seeing huzz, I don't care for just penis alone but seeing da whole twinem with da weenah hot lowkenuinely
>>562976298EB status??
>>562976481Shuts you up with her huge 42cm cock
>>562976561You will contribute greatly to my femra's breast fat. Thank you.
Palaistra is the only good CC map.
>>562976461how about hand holding then....
>>562976494I can't believe I never saw this connection.... Maybe it was over before it began>>562976571EB'd to her imouto
I sensed good things being posted.
>>562975871hm
>>562976657It's volcanic.
>>562976729well if she's already EB'd can my femezen be their pet...
>LIST OF QOS/BLACKED EBINSREKKA KENSEIKO GEISHEISARAN MIYAKECLOVER WEISSRIKKA TSURUGIGAR GALONJUNIPER GLADEWYNDLHO ANWYNHOLLY JOLLYARIA ORCHESTRIAKYOUKOKO KYOUKOSUN ROSASHERRI LAITELLEEIKI SHIKIREREKO REKOMEIWOWO MEIWOIKUA RALILIANE BLANCSANDRIS NOLANHIHIMI CHEREJEAN CHARLEMONTECHLOE SCARLETMO FUARANDO PEAMBRANDO PEAMRURI TORAMUFFY MOGGRACE WELKINATMA BUSTERTOZER BEAUSARAN MIYAKE
>>562976026>raenuh huh
>>562976657sis u misspelled clockwork...
Not enough lalas
>>562975562schizo post
>>562976724She'd have to think about it..
my femra is unaffected and bored by the powerscaling argument because nothing exists outside her and you're all only powerscaling because she thought it'd be cute and willed it so>>562976729my femra sees all so I'm glad I could give you sight
>>562976816That’s a lot of darts anon.
>>562976816Mo Fu was only blacked for a week, she already left the discord a long time ago so you can remove her from this list
Housing anons, please help. Are there any decently sized items that prevent camera clipping but DON'T attract wall hanging items?
>>562976856Correct.
>>562976657truthNUKEEEEEEEEE
>>562976540You should make more explicit stuff with her
>>562976771>>562976842Palaistra is the best mapThe only people who hate it are melee players mad they can't dive ranged classes
>>562976816muffy is blackhow does that work
WE NEEDMOREFEMLALAS
my femlala's name isnt on that list because she's racist
>>562976956Eastern Indoor Pond
>>562976901what did i tell you about making me think you're more cute than I already do
>>562976979I can't ask this one to sit on my face, she tastes kinda funny
>>562976996There's a few non white characters on I wouldn't think on it that much
my moonie has... grown... something...
Whatever happened to Mo Fu? Haven't seen him or his boyfriend posting lately.
>>562976809We could be convinced, always need something to experiment with...>>562976901Hmm, well my loli isn't even the strongest being so be glad she allows to have your delusions
>>562976159what is that thing and why is there ash/soot smeared on its face
>>562976816saran is there twice
>>562976961
>>562977119growing plants this early? good work, moonie!
>>562977104my bad
>>562977148Chemod
>>562976939>Mo Fu's boyfriend desperate to convince himself he's not a whore and he won't cheat on him again this month like he did last month
>>562977119Sis you should go to a doctor and get that checked…
>>562976901powerscaling arguments are fun though... well as long as people are doing for fun instead of wanting to "win"
>>562975557
>>562977042true
my meena? bing chilling
>>562977175this is my fav thread femra. so pretty /pet /pet /pet /pet
>>562976979I'm thinking sexo
My femra's favorite jobs? DARK knight and BLACK mage, why of course!
>>562976816bloonie doesn't even plap lmao
>>562977175
>>562977119a sick crab hand?
>>562976979But anon.I thought about making a femboy clown for that
>>562977361lmao
The performative outrage around blacked gposes continues to be funny
fr fr
>>562976359If I bought you dinner first would you...
gumo i think i caught a cold or flusurely this will not impact my ability to clear the raids today>>562976816who the hell did i get blacked by, the tyrant?>>562977172i think that means i got unblacked like a double negative or smth idk how that works
>>562977042Is that Kyoppi
>>562976064wouldkeep her pregnant and barefoot at alll times
>>562977417Sounds good
>>562976420Hey.
>>562977424yeah i'm sure you'll provide evidence any moment now
We leaving blacked in 2025We doing BLEACHED all of 2026
>>562977424He's right tho, I don't plap because it doesn't interest me
>>562977305>drawn in vagina bonesLOL the absolute state of femlalas, this is like painting your abs to look fit
>>562977372
>>562977402"never end on a loss" niggas
>>562977417Awww I kinda wanted to see more sexy pics with herThough I do kinda want to comm you more of a certain femboy lala
>>562977531theo you're south east asian you're not white
>>562977469twinem!!!!!>>562976816Do I not count cuz I am part black... wait I just realized I never got with a dark-skinned huzz back in da day!
>>562977570those are skin folds
>>562977513#NEEDTHAT
YoshiP knocks on your doorLegend has it that only (You) know how to save FFXIV. He begs you for advice on what to do for the next expansion. What do you say?
>>562977570trembling scaly hands typed this post
>>562977458why are you skinwalking korra with old pics bro
/xivg/ x /blacked/ meet when? QoS tattoo mandatory. I wonder who'd show up...
>>562977586
>>562977570those arent vagina bones
>>562977704“Make all the jobs even easier, get rid of all savage, ultimate, criterion, quantum content and put those resources back into repeatable casual content
vagina bones?
>>562977734that's just lightcord
>>562977704just commit with the gachafying plan yoshi piss. we know you are planning itmight play the game tonight
>>562977653whats good sis how is m12 going
>>562977831are you a biofem
i miss grace welkin
>>562977905LOL
>>562977905yeah that's akemi
>>562977704Stop letting the tail wag the dog in FFXIV. Savage raids and Ultimates are fantastic content, but they shouldn’t be the primary force shaping the entire game’s design. The vast majority of players never touch that level of difficulty, yet so many systems feel built around it.Criterion dungeons for example, if expanded and better rewarded, could teach players positioning, coordination, and personal responsibility in a more approachable environment. They’re smaller-scale, less intimidating than 8-man raids, and can act as a training ground without the pressure of Savage-level expectations.
>>562977774
>>562976901>posting the googoo babies horsehmmm
>>562977972She already said she doesn't know how Akemi is
I tell people that some biofem ebins are trannies so that i can keep the biofems to myself
>>562978028any new pics of this boy's huge balls?
>>562977972but akemi is trans
>>562977704start silently cockwatching /xivg/ and discord servers and have modbeast ebins banned at random intervals
>>562977905Why are people obsessed if I'm a biofem or not :<
>>562978069favorite biofem?
it's week 9 billion and korra "pentaweave" ikoma "I swear I'm not getting hardcarried everytime" still hasn't:>cleared the tier>gotten a decent parse>had a week without a raiding incident>learned how his job works>learned how mitigation works>learned anything
>>562977980
>>562978054akemi doesn't know who akemi is either so it checks out
>>562978152why you pocketwatching twinem
>>562978019it's simply how my femra sees and dotes on the realities she creates
>>562977901WE GONNA CLEAR P1 TODAY!!!!!!!!!! Deadass im gonna ask each light party to seperate for slaughtershed so we can move quickly, everyone piles up in the middle
>>562978069FAVORITE BIOFEM THAT PUTS OUT??
>>562976843Agreed, need more lalas.
>>562978152i havent done any of those things either wheres my schizo spammer......
>>562975570my lalaboy is straight but wouldn't mind being EBd to another lalaboy
>>562978259saran and mioh
whenever my femra sees a femlala in a skirt she pushes them over so she can look at their underwear
>>562978097Only a wip pose file for a behind shot while in a moonie.
https://files.catbox.moe/dwkx06.png
>>562977704Say it, say my name!
>>562978362damn wish it was my sunnie instead, but also nice
>>562978173
>>562978396No one gets mad at you for being the way you are.
>>562978371this is your goonbrain on steroids
>>562978406/pet /pet
>>562978371I don't know if I could say I have seen worse, but this doesn't phase me at all. Am I cooked?
>>562978396GRIMGOR IRONHIDE
>>562978338both trans
>>562978267WIFE.
>>562978371What domain expansion is this?
imo i think powerscaling is actually kind of cute if it's like two kids playing with toys instead of people taking it too seriously
I think I should reconsider my choice of twinem
>>562978221what we do in our static is we have supports inside the hitbox and the dps outside so you're stacked by role but still in the middle, and its easier to set preset spots to spread that way, you could do LP1 inside LP2 outside too though
>>562978371
lol
my sunnie+ is a blacked blonde bimbo slut with fake lips, fake tits, a fake tan, a BBL and of course spade piercings in all the right places, thoughts?
>>562978497WAAAAAAAAAAAAAAAAAAAAAGH!!!
>>562978152>learned how his job works>learned how mitigation works>learned anything90% of the raiders I know don't do these, they just muscle memory every fight like they're one of these freaking things using guides as options to try out before discarding them on the pursuit to a tasty treat through bruteforce https://www.youtube.com/watch?v=75k8sqh5tfQ
>>562978371Crazy domain expansion
does db have a ritualpost for every ebin
>>562978518nah saran is bio, it's shan who's a troon/femboy/whatevermioh is TBD, has transGAM goontendencies but expressed in the manner of a woman whose eggs are rapidly drying up
>>562977704>Fujo full time on XIV forever or at least get other writers of the same caliber like Naotaka Hayashi>Fire the shitty writer(s) IMMEDIATELY- they are poison >Stop fucking around with other shitty projects and double down on XIV>Figure out how to better utilize recycled/old content (limited jobs are not the answer)>Skim out as much old MSQ filler episode shit as possible to make that overall shorter>Do a better job of actively & passively teaching your players how to both play and IMPROVE in your game. Casual fags can be easily converted to decent players which means they have way more they can do. Or just burn it all down and make MMO#3
>>562978543is it me
>>562978371What’s the sure-hit on this domain?
>>562978651Name one, a random one.
>>562978531what if it's 35 year old gams arguing about bardock vs omniman for 8 hours?
>>562978396Roshan
Thoughts? Wanted to keep it mostly vanilla, I'm sure there's a better hair/eyes mod, but a tiny bit of limbals in glamourer emulates the look well enough. Is there a way to remove almost all color from the lips without lipstick?
>>562978741the fat hroth one
>>562978519Im gonna touch you.
>>562978787No one gets mad at you for being the way you are.
>>562978771That's really good, nice work
>>562978673>zero evidencenice try chaser
>>562978741Lho Anwyn
>>562978771God this is so cringe
>>562978771without lipstick no
>>562978827Why am I getting namedropped so often now
>>562978746that sounds like taking it too seriously which is covered in my post
>>562978827EU Muffy Mog.
>>562978547wait thats acc genius, im using this. gonna try and queue for a p1 clear rn, also ty for da mods earlier this week! The Serif font kino
>>562978708mpreg
>>562978267yeah that's a wife
>>562978673they're all bio
>>562978741berke
>>562978893Nigga did you just skinwalk me bro.
>>562978932bioGAMs
>>562978904npnp, gl twin u get that clear>also ty for da mods earlier this week!that was me wife not me
>>562978874FAVORITE BIOFEM????
>>562978980Are you stupid?
>>562978958He hasn't posted all that much and mellowed out.Miki Simp.
>>562978874You probably pissed off some autistic by not letting him plap
>>562979001I dunno man I don't really care for posters genders irl
>>562978531I like the unique exploration of powers rather than just one character being stronger than you times infinity + 1
I think I wanna do some disgusting fish poses, do you prefer emotional disgust or visceral?no it's not gonna be lewdstill can't believe she said that
back in my day we confirmed biofems with tits or gtfo
No matter how hard you try you cannot force people that do not want to raid into raids that’s not how it works.
>>562978874you've been posting a lot specifically to be identifiable
>>562979027Yes.
LETS DO THIS!!!!!!!!!!!!!!!!>>562978994oop mb... ty for advice doe yuh yuh
>>562977704Consoledate the buttons for pve like you did for pvp you stupid fuck.Play a game of Frontline or cc once in your stupid Japanese life before you put a update out. Take a look at all the BH5 retarded invincible gun rebreakers running around with the invincible paladins and ultra EZ mode monks.Stop sinking our stupid fucking money in shitty flop games and roll hard in qol and the new in our game.Push updates faster, give more emotes and content.The next expansion should come out in half the time.Remove the report function for chat, it will regulate itself
>>562978874Congratulations, the swarm has decided to try to turn you into a lolcow. I would advise not acknowledging it after this point if you would like for them to get bored and move on to a new target.
biomalezen here
feels like every online dating success story i see, including xiv, is just when the woman puts in actual effort or randomly becomes obsessed with a dude for whatever reason
>>562979092
>>562977460I told before that I would only with someone I know well...>>562978679It's probably you....
>>562979092>still can't believe she said that?
>>562979092Visceral, why not.
>>562979093Saran and Shan both have posted theirs but Mioh reverse psychologyed the general into submission
>>562978920Hehee thank you :3 /pet
8:50 CC ET Crystal
>>562978741Korra
>>562979238>Saran and Shan both have posted theirsproof?
>>562979050I've been outspoken about not wanting to do any of that so I doubt it>>562979108I mean I've always gone through periods of posting the moonie more often and then less. Most of my posts are still anon>>562979153/shrug just odd to see is all
>>562978874>spam the thread with pointless shit every day>why am i getting namedroppedyou also reply to everything so go figure
>>562979275korra so creepy
>>562979169the latter is just your standard BPD whores bro, those are usually followed with the girl cucking the guy or breaking up with him out of nowhere it happened to me, NEVER go for a woman who's interested in you from the get go
>>562979092sum sweet and sowah
>not in the 'cord
>>562979169that's generally how dating works yeahgood luck!
>>562979169That’s what happened with me.
>>562978994you really posting titties twin? >>562979238
>>562979136>Stop sinking our stupid fucking money in shitty flop games>he thinks the former director of an MMO can tell the publishers want to do
>>562978820Thanks, I would take more angles but I feel like to make it any better I would have to go into C+.I wish we could customize philtrum width separately from the nose... I dislike the "dual dot" style of anime nose so the nice bridges of face 2 midlander is a good solution.
>>562979136>Remove the report function for chat, it will regulate itselfDude wants to flame people and be toxic without the possibility of losing his account
>>562979125Hello.
>>562979281the proof is a discord screenshot of a bunch of simps in saran's discord saying "omg she just posted her tits" after she said to type that
>>562979345i am going to kill myself
>>562979169you posted this shit yesterday
>>562979307I've done this for years that's the thing
>>562978353>she pushes them overThe average femlala has equal to more mass than a femra and can easily 1 v 1 your skinny ass
>>562977302first one of the day
>>562979340why did you get 7 damage downs
>>562979092I want you to suffocate me with your disgusting feet until my mind goes blank and I pass out
>>562979136>Remove the report function for chat, it will regulate itselfYou will not say SLURS IN CHAT
>>562979169If a woman genuinely finds you interesting, for whatever reason, she’ll do everything in her power to get your attention.
>>562978221korra if you wanna talk about m12/need a paladin you can hmu any timeI'm parked on crystal for the next few days doing oc so might be a lil bit hard to find me in game but I'm usually around
>>562979460and ramped it up recently to annoying levels
>>562979437Hello!
>>562979204>someone I know wellYou're EU and I'm NAIt can never be...
>>562979169That's usually how all dating goes.>>562979416Outdoor lighting might be kinder if you're still torn on her colors. Fog/Overcast at 11am-2pm is the light hack most people use.
>>562979482Ew.I'm not a left lala.
>>562979579If you say so man, I wouldn't say I've changed the amount I post overall but for sure I've been posting the bloonie more recently
transpiracy theorists on both sides are just making shit up now and beamclashing their made up shit
Soupy...
>RueDropped.
what if we made new characters with identical appearances and we roleplayed as twins?
>>562979491Well... Whilst I was progging before clearing M11S, I was still learning orbital stampede and during the roundabout section of it, I accidnetally stopped just a bit short of the clockwise movement, tanking 5 AOE puddles at once, the other two DD's came about from Orbital stampede, one during the first one and one during the second!
These guys look very heterosexual.
>Korra still butthurt about being a shitterlollmao
>>562977704add an active time maneuver where you have to get Gaia and Ryne pregnant
>>562979715what if they, y'know..
pretty funny watching them scramble to find a new target now they finally figured out that lientri never entertained them
>>562979643I manually turned the "sky saturation" in brio to 0 there, is there a better way? Good point about the hair, I just think brightly colored hair in xiv looks WAY too cartoony
Ecks Eye Vee Gee
>>562979732rudegonna tell them you said that
>>562979169I did this to a male middie from here and we’re happily together :3
>>562979672transvestigators chasing after transpiracy theories during their transvestigationhehe
>>562979715only if they're both lowlanders
>>562979574RAHHH!!!!!!!!!!!!!!! TY TWINEM!! I'll hit you up when im progging P2 fr fr, im heading to NYC tomorrow so imma not be on till like sat night fr fr...>>562979676this deadass one of the top fiddies
what if I made my galter a korra clone so when he says twin he means his twin
i still haven't cleared m11s...
>>562979828How did you get into AQ from FF14?
>>562979825I just fiddle with the time and weather and leave the rest alone because I'm stupid, but there probably is a better way to go about doing it.
>>562979828i look like this>>562979908GOOD LORD
>>562979908hey just wanna say thats awesome
>>562979367it was a pic of a plushie i was hugging with my chest in frame and i deleted it after realizing that it didn't really need to be there since i sent it on impulse
>>562979672>>562979902please take a shower and go outside
11:40 CC ET Crystal
>>562980061why... I just think the terms are funny
>>562979792kissed...?
>>562980059autistic women are so cute bros it's unfair
>get rescued into a mechanic THEY messed upihateyoudiediediediediediediediediedie
>>562980059nigga in the nsfw channel?
bored
>>562979908
>>562980159you gotta embarass them like saying "you really wanted me to fail that with you didn't you"
i think i accidentally stumbled into a discord server can someone point me towards the final fantasy xiv discussion thread?
>>562980059ahhhHhhh I’m dyinggggggThe doctors say the only thing that would save me is that picture aghhhhhhhhhhPleaseeeeeeeee don’t let me dieeeee pleaseeeeeee ahhhh
>>562980260Hi bored I'm moonie
>>562979562I think I'm just radioactive because after the last few years of cultivating some personal hobbies, getting in shape and being generally happy with myself, I still have never had a woman show an interest in me in that way in my life.
Ocean fishing boat in just under 10 minutes, join on Aether for an attempt at Hafgufa and Placodus!>>562975557lalafell :]
>>562979297You're getting acknowledged because you're well liked.
>>562975557I've consoomed, and I don't regret saying this, this bike is cool
>>562977224Doesn’t that involve some kind of drama in order to push them out? They were here one day and then not the nextMy bet is on alts
>>562980363rape
>>562980302I got you king https://www.reddit.com/r/ffxiv/
qrd on chloe scarlet
>>562980059I'm going to need to see those plushies in my DMs, the tits too, but mostly the plushies.
>>562980363Put on some skimpy panties.Ass shot of you riding it.Now.
>>562980421pink
>>562980363it's so fucking small on lalafells even though it shouldn't be, it's the same size as the other bike mounts when this bike is supposed to be much bigger than them
>Face 3 lalafellI laugh.
>>562980302he says not talking about ffxiv himself
>>562978673I'm genuinely interested in it if you have anything specific pointing to Shan not being female. I'm on the fence because interacting with them feels like interacting with the biofems I know.
>>562977148People say they started new elsewhere which is makes sense with their archetypes but I haven’t been able to find anything on them
>>562979969nanomachines.
>>562980317still cute
>>562980363Need you giving me a reach around while we ride that bike.
>>562980547waaaaaaa you're so good at these, I'm so lucky ;w; thanks again ^^
why do EU people care so much about what other people do?
>>562979664Use critical thinking, nigga.
He doesn't know it yet but he WILL be mineI just need to get trapped in the crystal tower together at the end I think I can do it
>>562980330Maybe, maybe not. I know for sure my posts would annoy some as that is the nature of this site as a whole
>>562977617yeah sure
>>562980496GAMs tend to act overly feminine
>>562976026Femra will say this to your face and expect you to take it seriously while they look up at you from 4'11".
what if we stared into each other's eyes...
>>562980678I should have made a catboy galter
>>562980140when i was in hs i was friends with a really cute aspie fujo who walked everywhere on her tipitoes despite being like 6'1" but nobody was willing to approach her because she was really autistic about stuff she liked, she is to this day one of my best friends>>562980239we go a lil off topic>>562980306sorry buddy you're off to the shadow realm>>562980461im not posting THAT pic but i do have a lot of plushies, my fav is this triceratops i pulled from a crane game at a gatchapon cafe that i take camping and this tonberry one of my best friends sent me for my birthdayhttps://files.catbox.moe/z56sdd.jpg
Aye how do I Is anyone around to help me clear P1 of M12S tonight? going to gym in like 20...>>562980059twinem posting da sonic plushies>>562980421huzz!
>>562979648I'll turn into dust now>>562980640Wasn't sure if you saw that drawing I have all of my stuff tucked away. Glad you liked it
Should I log into my shotabait fiddie or play something else
>>562980678bitch comb your goddamn hair
>>562980656Bit rude asking a moonie to think
>>562979136Tell me this isn't you without telling me this is you
>>562977148they broke up. mo fu is laying low to avoid schizos and his boyfriend went back to /pso2g/. chloe was bragging about breaking them up for a couple of days, but cut back on mo fu's request.
>>562979158I'm more of a full metal field malezen myself.
The absolute fiendish behavior when that fat booty GAN-lala posts is crazy.
>that moonie with ALL the braincells
>>562980815ill harass you if you do
>>562980708Yeah, that's my point. She talks normal but clearly has politeness beaten into her. Have you ever interacted with this person? I said I was genuinely interested in hearing what you have.
If Korra said he f/w'd me I'd probably change my name and move to Canada
this is what happens when a NEET has nothing else to do with his life
>>562980909me
>>562980759what if the tips of our fingers touched, and then we pulled our hands back a little, but then we did it again, slowly...
this game kinda sucks ngl
butch biofem playing a male character eb for my hyperfeminine girlypop gamra
>>562980890Me when I have no idea what i’m talking about
>>562980771well im completely shameless so im asking for it next time i see you and you're not at work
>>562980909is it me
>You don't get it, I'm a SERIOUS roleplayer>I need PLOT broCmon, stop beating around the bush, you just wanna fuck my g
>>562980909It'll never be my moonie..
>>562980363it was fun drawing this ones big butt yesterday
>>562980760It's not too late! Join us!>>562980818Nope
if your femlala isn't hypersexualized with huge thighs, huger ass, hugest butthole and giant breasts you're basically a pedophile
>>562981014towa....
>>562980958and then instead of touching our fingers again, i move past yours and take your entire hand in mine instead...
>>562980931How would you do that?
>>562980623>>562980416oh my goodness gracious>>562980465later, going to primal.>>562980479Small indie studio. Can see it's got almost the same animations as the Air Wheeler, idling and moving, at least.The Garlond GL-IS was the last bike they made that didn't scale, right? I don't know if anyone complained about it.>>562981032thank you again, anon.
>>562979169yea pretty much. ive done this to a guy twice, one was a good relationship that lasted 5 years and only ended due to circumstances outside our control, the other is ongoing but has been great and looks promising for the future too. other relationships that i didn't pick out the guy i was interested first, but rather let someone pick me out, all had troubles of one kind or another and usually ended within 6 months or less.
Race+gender postingNothing else matters This is why we play xiv BAYBEE!!!!!!!!
>>562980890this is probably bs but I kinda hope its truemofu doesnt deserve to be happy
>>562980140you say that, but thats until you actually have to deal with them. i think the idea is more attractive than the day to day reality of being with one.unless u have the same type of autism urself
>>562980121What if we had a kiss x sis dynamic...
>>562981017can't i want a little bit of both for the most enjoyable experience
>>562981113duskwight female:D
>>562981063By sending you horrific tells on my shota, duh...
>>562981113He says not talking about the game
>>562980690You're not hated in a sincere light, how schizos operate is like this, and this is speaking from experience.>Go after someone that gets little to no drama or attention>Say something completely new to catch their attention>They either respond defensively or confused>Don't elaborate to them to leave them curious and questioning of their situation in current space>Keep doing it to cement it further on every encounter>Other people show up to defend them and argue either for you or against you^ This is the part that matters most. That OTHER people like you. That OTHER people get dragged into the mess. This is what is getting you attention more and more.For every,>EU Muffy MogThere's a person that goes,>No, not even close.Then you keep reeling in that engagement. People pay attention to ritual posts for any "anomalies" or "differences" and then focus on them more and more. It's not about hurting you to them, it's about using you as a medium to make a mess. That's how schizo shit always works.
>>562981164Yeah, I guess. This is probably the way, in fact. I just get annoyed by ""SFW"" roleplayers acting all high and mighty for no reason
>>562981157Thatd just be ripping off the shanran duo you should do a mom daughter relationship instead
>>562981087Hello my wife
>>562980885>giving reasonum xixtexr they no longer give reasons
>>562980059>>562980771is this saran or shan?
>the one time I don't thirstpost him he responds to thirstpostsits over
>>562980903I'm not gay but I would genuinely tear that nigga apart. He's so fucking thick, god. Reminds me of Timmy Thick
>>562981164>hitto in the background
welcome to hell, retard, ur the first one here
Moonie for my face 1 fem(this stands for female btw)ra plox>>562981176So true sis
>>562980701What are your price now?
>>562981401Damn bitch, you fart like this?
when moonies aren't on the screenanon should be asking "where's the moonies?"
>>562981086Gonna queue up for RW so I can cop a feel on this he/him bustyboy…
>>562979715with how few good character options there are most of us already have at least one of these already
>>562981367>i have relationships with women and sex with menwell i got news for you, king. that means you're gay
>>562981173How come I think you’re lying…
>>562981324I accept your concession
>>562980909this is absolutely my mooniehttps://files.catbox.moe/a146k9.mp4
>>562981449I say this but for Khloe Aliapoh ToT
>>562981481we need to have the same surname and be on the same world so we can EB
>>562977704romance options
My femlala woke up with brainfog
>>562981447those are vapors from the swamps of boiling sulphur
5:10 CC ET Crystal>>562981434DM me
>>562981367Timmy thick mentioned
What is the proper way to mark your character as + on flist?
>>562981509Because honestly there are a lot of people shitposting about them here that don't actually have them, so I don't blame you. This is one of the few times it is not shitposting
>>562981270it's just more fun with a little bit of foreplay and set dressing and surrounding plotnot that i partake much lately..
>>562981581stop huffing cock musk before bed
>>562981401loathsome dungeater ending>>562977704rape options
>>562981>>562981594That looks like stink clouds. Just letting you know.Reconsider.
>>562981147I don't care. People cheating in PvE content doesn't affect me.
>>562981581I read that as brainfrog
name a femra QUICK
>>562981594it's incredible how repulsively gay you look
>>562981581my femlala wants you to take this /hug
>>562981647I posted this last year KEK>>562981508Nahh I'm str8 as an arrow
>>562981661Cuteeeee! What do you do? RP or animations?
yeah I'm lowkey a freaky nigga who wants to suck on Otis' toes what of it
>>562981807korra
>>562981807THAT one
my femra basically invented mustard
>>562981819/happy
>>562981647Why do men marry women anyways? They get old, flabby, ugly, and they don't even give good head like a man does
>>562981842Thanks for the update
>>562981331yes
>>562981807Tamashiro Furukane
wtf is a left lala?
So is muffy also pale glint?
>>562981807I wish I knew her name... But she's a cute pale face 2 xaela
>>562980363>>562981086>A lalaboy gets to pound that every night.
>>562981825RP, animations don't really look good normally and they especially don't look good on smaller bodies. Maybe throwing them into a scene if setting it up with heels doesnt take too long...
>>562981807Ranru
>>562981921nopale glint is medium lady
>>562981953I’ll have to find you one day then
aye deadass shoutout saphhic love
>>562981254That's one way to look at it for sure, but I'll still assume there's a non zero number of posters that dislike my posts as that's most likely the case. Either way I'll still post bleppers
>>562981579It will end like this!https://files.catbox.moe/2fy55z.png
>>562981447
who the fuck gets on this game and says "yup im gonna turn my male lalafell into a femboy shortstack with a fat ass"
>>562981807Thread Schizo
A Moonie approaches.
>>562981917A left lala or otisfell is basically a shortstack lalafell.We have a chart for this
>try to load a pose in anamnesis>it throws an error about not being able to manipulate bones>brio can pose just finetime to take this program out back
>>562982095Nasty!
>>562981850I give it a year before he troons out. He’s already a femra playing parsetroon and he’s only been playing the game for like 6 months.
>>562982015Could be today if you actually do hop on your fiddie!
>>562981754wookie cheats in pvphe forgot to turn it off for pve
>>562975557K
>>562982091unironically my favorite critter
>>562982095Album?
>>562981050jesus thats an ugly character
>>562982084weirdos
I see a fellow hrothgalI hit the /humLife's simple like that
Bros I had a dream about someone from xivg the other night and it felt like a blessing from the skies above itself.I woke up yearning hard but I have never interacted with this person and have no feelings for them. What the fuck
>>562982154I genuinely don't give a fuck, dude.
>>562982095>Hair clipping through the breastGod this retard faggot is fucking useless.
when did showing passion for your friends start getting viewed as desperation, i tell someone i had a good time and want to hang out again and they disappear...
>>562981579Gaia every time, final answer.
>>562982256Who was it, king..
>>562982095my fave moonies that is built for wrapping around like a body pillow
HeyI miss you/pet
>>562982029>sapphicTRANNY TRANNY TRANNY TRANNY
>>562982284so stop replying
>>562982223>>562982084These are jealous femlala posts.
>>562982289Treat me like shit and i’ll stick around longer
>>562982063This is honestly terrific, I can't lie. Good work.
>>562982029are you a tranny
>>562981814yeah, thats the idea.
>>562982357"No."
what game should i buy on steam so i can play something that isn't ffxiv
>>562982289How do you know they think you are being desperate? Maybe they just don't like you that much and don't want to hang out again.
what does sapphic even mean? sometimes you act like a whore???
>>562982256They like you and theyre trying to worm their way into your minds through dreams. It is a dark art. Take care of yourself.
>>562982284You should.
>>562982357Stop posting that shit then, why do you care about some dude cheating so much? Do tell me.
Does anyone have any good mask mods they can recommend for female characters, particularly Venetian or masquerade-style masks, ideally full face?That's something I find really hot but almost never see anywhere, and I want something to recommend to a couple of friends who are thinking about gpose commissions with my character.
>>562981807???
>>562975871
How long before we get an influx of he/him bustyboy malelalas?
>>562982095>>562982287he has brown skin so he doesn't think beyond bobs and vagene
>LalafelDropped.
>>562982403>>562982436thanks for your caringheres morehttps://www.fflogs.com/reports/QJxzGhZbYK1Caj7X?fight=11&type=damage-done
>>562982436Why do you care about some dude posting about him cheating so much?
>>562982419relating to sexual attraction or activity between women.
>>562982419it means lesbian but includes women with girldicks
>>562982429Oh? And why is that.
>>562982342>>562982389nah cishet man irl I just be inclusive fr fr
>>562982256God i wish it was me
>>562982342Honestly I find fat women use sapphic more than anybody else.
>>562981915really fucking cute femrar btw
>>562982565>>562982419it's closer to bi and does not include newhalves
>>562982550thats impossible, cuz only men are capable of real love
>>562982469this post explains a lot of the schizoing happening right now
8:45 CC ET Crystal
>>562982572/smile
>>562982287is there a mod that adds bones to the omega-f hair because that shit is annoying as fuck>>562982331moonie soft and warm>>562982497post your dna sequence and if you are even one percentage point more aryan than me i will never post again
>>562982727but it says low???
>>562982741am i allowed to queue for cc
>>562982438I saw one like that on unvaulted, let me see if I can find it. Is this a femezen because I'd love to see the results..
can I get a qrd on the he/him pawgafell
>>562982779Eugh!
>>562982816depends on what job you playyes
my femra's eyes felt weird so i took them out and maybe im starting to regret that
>>562982779>aryan>he said ARYANLOL
>GANiggcess taking all the (you)s that my flux using femlala used to get.me femlala hate this.
>>562982746craziest logic on display here
Queueing for CC = Consent
>>562982875drg or smn, depending on my mood
>>562982779
>>562982779>post your dna sequencedisingenuous request but honestly i'd consider it if i thought for a second you'd honor your challenge and i'd never have to see your awful jeetbrained posts again
you want a good girlbut you need the bad sissy
>>562975871My mooner got this
I genuinely think Family Guy is funny.
>>562982957queue up bro lettuce suffer together
>>562976197I really have to get this off my chest but there's so much off with this one image I usually love buff chicks but some about the lighting and whatever texture they used for the skin makes her look ill.Don't get me started on her abs, they're so defined to the point of looking like a water balloon stretched across a grate.Now maybe it's just the lighting or whatever but around her naval may be a tattoo but I assume the discoloration is blood flow(?)Positives though I'd that this Swys looks pretty, outside of the pose she's probably hot, and the outfit is nice... Just that the rest of it looks horrid.In conclusion I'd let her crush me
there's nothing worse than a fat tranny
>>562982935>I AM BLOODY ARYAN SAAAAAAR I AM ARYAN
>>562981997who is the "large lady"? We must think... Bigger..
>>562982438I got youhttps://www.xivmodarchive.com/modid/80362
>>562983035a fat balding tranny
>Chloe Scarlet "depressed" againDoes this bitch every have a good day?
>>562983035I dunno. I think taxes are pretty terrible but that’s another thing entirely
>GAMcess>Pawgcess>He/him pawg>GANiggcess I am never leaving this general.I was in a bad mood but now I'm not.Thanks /xivg/
>>562982385every time I see this pose I remember Riallant calling you a little faggot with almost that exact same screenshot
Playing GNB in cc = consent
>>562983106no loli stopped talking to him because he was pretty much always a miserable fuck in private
>>562979906>the most annoying faggots all lined upI feel bad for alter having all these retards hover over their FC
my BPD score was kinda high so I'm not gonna post it with my character so people don't know to avoid me
>>562983149>I remember Riallant calling you a little faggotIronic considering his tastes in trannies.
>>562975871My [REDACTED] got hurt by a 100% recently.
>>562982779>post your dna sequencehere's a sample i guess ATGCTAGCTAGGCTTACGATCGATCGTAGCTAGCTAGGCTAGCTAGCTAGCTAGCTAGGCTACGATCGATGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAACGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTA
imagine telling other people how you feel
>prove you’re whiter than me>”thats disingenuous”Lmfao
>>562983232it has pretty much never worked out for me, yeah
me dogboy is aryan and sent the dogger race to reduce the quality of this board
>>562983141>good king moogle mog>he/him pawgthis one always gets me
my moonie basically invented sauerkraut
>>562979906thats a lot of cheaters and incompetent players in 1 picture
>>562983227cloning this anon to be my underdesk suckpet
>>562983185Which one are you
Imagine feeling
*coughs up blood* j-join my m10s clear pf on aether,,,, blease,,,,,,,,,,
>>562975871I did so well!
>>562975557lalafellfinally done with the pvp grind
my fiddie is kind of tired of it.everything.
>>562982469Queen Appal can you ask Lord Heiko when are we going to move to a new spot? Because the current spot is a big yikes from me. Too many non-ebins messing up the vibes, especially when we all come to 4chan for a comfy and eepy wholesome time. We need to cleanse the ranks of lowly filth by bringing the spot somewhere secret. No alts, no thread peasants, and most importantly, no one that’s not in the ‘cord with us.
Imagine being a sentient being
>>562983206Yep. Common BPDemon behavior. Hiding their shit traits then turn the life of someone innocent into hell.
>>562983261Just say you don't know what a DNA sequence is, saar.
>>562983261no, expecting me to post DNA results on 4chan and expecting both of us to do so honestly is disingenuousbelieve me if i had a real verifiable shot at wiping ai kotoba off the board forever i'd take it but this ain't it
>>562983272>boy>female characterloser
>>562983357>SentientFUCK OFF BACK TO TAU MOTHERFUCKERS
>>562983338thanks, female otis.
>>562981807Why would I name her Quick, that sounds as dumb as naming her Soft Doll or something
>My Tomestone and FFlogs gets updated by someone every week
>>562983341i'm about one inconvenience more away from blowing my shit shmoove off at any given time
>>562983347i cannot ever take kawaiitely serious again after learning he not only is into sph but also chastity cages
>>562983361I don't think I've hurt anyone... if anything they hurt me... and I let them...
I just realized, when people here say "fakenice", do they mean being POLITE?Yeah I don't shit talk you in public man, that's called being polite! Even if you don't say it out loud, you've probably thought someone was annoying or rubbed you the wrong way once!
>>562983347do ANY of these sewer skinks like femezen? O_O
>>562982095Get down Mrs. Mooniedenthttps://files.catbox.moe/ts48qr.jpg
taking an obvious exaggeration as a serious request simply because you have a hateboner for the grown ass man who posted it is hilarious
>>562983341What's wrong?
>>562983445is it me
>>562983445both mei don't want to schizo you, I just like knowing how you're doing
>>562983341same sisidk why I even log in anymore I hate the game and most of the time the people I call friends
>>562980760What's galter? Did they make a 4th alter?
>>562983218DB you proudly admit you want to suck H'ana's cock and you actively are more interested in his male character than his females
I didn't catch either of the ocean legends, might kill myself
>>562983398*adapts to your hate*Nothing personal fleshbag
>>562983292just because your moonie put her cabbage and bag of salt in the same bag so she wouldn't lose them and then forgot about itdoesnt mean she invented saeurkraut
>>562983434i know soft doll lol
this grown ass nigga just ejaculated all over his phone
woo
>>562975871My femra is uhh..... not surprised by this
>>562982938Sounds like you need to show more butt.
>>562983579I'm sorry to hear that, I hope she gets better soon
>>562983460wha'ts wrong with that?
>the jeet who asked himself for an "Album?" without realizing there were thread IDs is now "anonymously" vagueposting in his own defenseat least you're consistent, saar
>>562982584 >cishetnigga u ask to see cocks almost everyday
>>562981050>Join us!I did, I'm just not a catboy so you didn't notice
>>562983491Now we're playing victim... Not looking good for you.
>>562983398Do you think Caliban is like a hapa chud? Would he post on r/TauMalePride?
>>562983663qrd?
>>562983525my retainer has been renting out my house as an air bnb and putting all of the overhead costs on my credit card
>>562983347oh shit thats me
>>562983663did that actually happen LOL
Men are only picky when>A: a race/gender completely fall out of their tastes (No lalas, no men, etc)>B: they are virtue signaling for their own clut (femra cult, lala cult, etc)Otherwise IRL men will potentially fuck anyone outside those two situationsBioholes are the only ones who are genuinely racist.
>>562975871Good job self
>>562983663>take someone's picture >post it>reply to it Why are the schizos so lazy and boring today
>>562983417np
>>5629834965 out of 6 of them are transsexual futa players and the 6th quit the game.
>>562983495There are a lot of autistic people here.
12:40 CC ET Crystal
>>562983681I'm sorry... please forgive me... if I hurt you I never meant it and it hurt me so much more than you can imagine...
>>562983569yes it does
>>562983498I gotta stop clicking random catboxes
only schizos take that test btwgz on outing yourself
>>562983718>>562983750it was a falseflag
I wouldn’t fuck an Indian woman
>>562975557Hell yea>>562975871I swear it's just 3 different comorbid conditions and countless shitty social situations growing up giving me brain damage. I hope, at least...
>>562975871Ughhh I failed the testHow am i supposed to be a bad bitch without bpd? Is it over for me?
>>562982860>Is this a femezenSorry, midlander male. The mask would be for the other character in the pose (and I don't currently have any femezen lined up).>>562983102Ha! Completely different vibe from what I was going for, but I might keep that handy as a silly gag.
>>562983149why do you think he copied it and has been melting about melf, his brain was COLONIZED
>>562975871normalfag sisters...
>>562983913That's not good, you seemed more normal.
>>562983838oh ok
imagine if we had IDs
Deadass i'm normal?
>>562983783>>562983876they tried to do the same to Appal with the "Cute fish" thing
What's with all the fake low results?You're on 4chan, you are NOT that secure and emotionally stable
imagine if we had country flags
i could never marry a femra i would end up accidentally smothering her to death with affectionmaybe its for the best
>>562983989Nigga he larps as a fat chud, do you really think that’s normal
>>562984024Korra...
Imagine if I had you…
>the fat trans vampire lala seemed "normal"
>>562984006it'd literally be one schizo replying with anything and to anyone with 120 out of 800 posts like it happened on the other site
>>562983876he's just replying to himself
>>562983913Which ebin is insane enough to crack bling bling boy over here.
i hate going on primal for meetups its dangerous on that data center
im feeling really gay guys
>>562984062>>562984097"he" is FtM too btw you know in case you needed even more?
>>562983218You have stalked, sexpested, and melted about every tranny in here, as far as I remember all he did was say he doesn't hate trannies
>>562975557>>562975871quack test tbdesu
>>562984037I took the test multiple times and posted the result I was happy with.
>>562983798Well, yeah, I know where we are, but like, I thought that was just common sense!
>>562984081
>>562984037>tsch I go on 4chan, I'm emotionally dark and twisted like Shadow the Hedgehog heh
nobody wants a fiddie that scored a 50
>>562984074we are all deadass inclusive of gay, straight, bi, lesbian, trans, all walks of life here doe
>>562984192Time to dick him down so well he turns back into a woman
>>562984248You're not getting a fucking 0% on the test bro this insecure reply is literally proof of itTry again and be honest this time
>>562984037I have used this site for far too long and have been considered a normie by many anons at this point
>>562983826Freak.
>>562984037I’m here because I’ve been here for almost 20 years, not because I’m maladjusted.
>>562983010sounds like someone is scared !>>562983227my moonies looks like GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT>>562983498thank you for your service
will my femra find love today on balmung?evens yesodds nozero she gets raped and murdered
>>562983460sounds pretty based tbqdesu
>>562984375Gross!
>>562984379can we make it a zero anyways
>>562984349I don't remember writing this
>>562983767this femlala looks like she's very talented
>>562984379lol stupid chudra, you leave balmung if you want to find love
>>562984375this moonie would look based tied up!
>>562984353I think it's weirder not to feel this way... everyone is so cruel and emotionless... like zombies... I bet you take SSRIs...
>>562982168I'll try keeping the lalas closer to the image given.https://files.catbox.moe/70lbcd.png
>>562984446i'll reroll it but I only have 1 command point
>>562983106why is romani leaking private conversations?
>>562975871ironic considering i was diagnosed as a teen
>>562975871i'm emotionally dark and twisted like shadow the hedghehog heh
>>562975871Neat :)
>>562984541Well, it's not an accurate test.
>>562984453Anons cannot comprehend it sometimes, there's just something about shitposting that I'll never be able to kick the habit I know that in my bones
>>562983498>No one has tributed my femra yetfuck my chudra life
Is the bloonie still here? I want to talk to you for a second.
>>562984548+?
>>562984341what are you even trying to prove?that deep down everyone is as ugly as you?
>>562984341Nta but I got a 0%
>>562984248Shadow the hedgehog's actually one of the most mentally/emotionally grounded characters in the franchise past his introduction and gun game
will my fiddie find love today on balmung?evens yesodds nozero she gets sexpested by annoying people
>>562984548does she like fiddies
>>562984548saw this rabbit not wearing underwear in public the other day...
>>562984548I deadass can handle the huzz>>562984212twinem! ty for serif mod shi go brazy
>>562981658t4t
>>562984234don't let this schizobabble distract you from the fact that Hector Hectorson is going to be running three femras, with mirapri glams. And on top of that, he just went into XMA's discord, and he comissioned three custom facesculpts, with MAKEUP, and a tail mod.
>>562984675>twinem! ty for serif mod shi go brazyu got it wrong again bwo...
>>562984608Do ya mean me? or a different one
>>562984647it's utterly over.
>>562984375Your moonie is more like MOOOOOOOOOOOOOOOOOOOOO
BPD aint real you're just an asshole
>>562984735bru, oh wait Saran twinem got da femrala fr fr
>>562984779Yeah! You're into Blender, right?
>>562975871Here we go!
>>562984601It's just fun, there's really no other place like 4Chan
>>562984885you like lalas now? lmao
>>562984595WIFE.
>>562984541I diagnose you with wife
>>562975871my fiddie is incredibly well adjusted
My wife.
>>562984687The fact that “f+”’s don’t consider their characters trans is just the last in a long line of baffling delusions held by futards.
>>562984885i got two i got the blonde and the brunshan's got the shantotto lala
>>562981940yeah, he's great...
>the actual schizos all get 0%
>>562984906the prettiest moonie
>>562983913disgusting shapeless michelin man legs
>>562976816give us some screenshots cuh
>>562985036they both ended up with these looks after pandaemonium but they werent talking do we believe it
The fight itself was lame, but the music made me want to start skanking and bringing out my checker pattern belt.
>>562984507I like the annoyed expression
https://files.catbox.moe/owizue.mp4
We should bring up the 16 personalites test again so I can laugh at how many introverts there are in Final Fantasy XIV: Dawntrail
>>562984375Thanks for your moonies
>>562985109if youcaaaaaanbelieve itthat's exactly what happened
>>562975871yeah
>>562985054real knowers know that ones with higher scores are more than likely foids
>>562984962What?>>562985036wait have i been speaking to saran this entire time... i'm sorry twinem...
>>562982584is it true you ask to see cocks everyday?
>>562984973Yippeee! its gotta be autism.
>>562984905I'm nyot the most knowledgable on it if that's what you're asking but I can try to answer whatever you're asking. You might be better off putting that question somewhere else mind!>>562984952So true man
>>562985267Boring.
>>562985054>pick the normal answers>get 0%r u srsly surprised?
>>562985171Kino
>>562983291Same. Now everytime I get moogle king mog in a trial roulette, this will pop in my head
>RueDropped.Wrong pawprint retard.
If you post 0% on the BPD test I'm unironically wary of you and probably going to avoid you since it means you don't really experience human emotions and you're probably going to shit talk or even schizo me behind my back
>>562985267PEAK
>>562983913Your characters are funny but everything you share about the pilot makes you seem like a deeply unpleasant person.
>>562984906this looks retarded
>>562985171>not aislopWTF
please don't use the term "suckpet".......
>>562985267HOLY FUCKING SHITTTTTTT!!!!!!!!!!!!!! >>562985259Futacock is DIFFERENT ON MY MOMMA!!!!!!!!!!!
>>562975871you people are freaks
>>562985267Janny is gonna FREAK
6:40 CC ET Crystal
>>562985374How so, schizo-kun?
>>562985324This nigga loves bbc
>>562985240can u rly not tell us apart bwo...>>562985340u dropped these>>562985346its fucking over
okay then SUCKSLAVE
>devs listen to the thread for suggestions for stuff to add to the game>one of them will be randomly selected like the housing lotteryWhat do you suggest to be added to the game?
>>562982746If this was actually wookie, it's brutal lmao
>>562985389If you'd just said, "her eyes are not looking at the camera" you wouldn't have given yourself away.
>>562985456
>>562975871what ever stupid test anyways
>>562985487I've talked to a bunch of the 0%s actually and they have like... literally no empathy at allCompletely self absorbed people who don't even view you as a person
>>562985447ok vacuumra, get to work*hands you a maid outfit and a house vacuum*
>>562985267really cute actually
>>562985267does she like middies
>>562984603Face 1 or 4 femra post
>>562985557given what away, i think the mouth looks ridiculous in that emote too
>>562985171Fiddie run looks so damn good on femra
>>562985452>Futacock is DIFFERENT ON MY MOMMA!!!!!!!!!!!faggot in denial
>>562985510playable lowlanders DUUUUUHHHH
>>562985487no no, I can! with da femras fr fr... I just be forgetting who is who wit da small jits... I'm sorry twinem...
>>562985559
Is this game tricking me into fighting Ocelot, but as a duskie?
>>562985171Never forget that halmarut invented morbols
i'm glad xivg has moved beyond the "celebrate their mental illness by maximizing their mental illness scores on shitty internet mental illness tests" phase
>>562985510Complete combat overhaul to be more like TERA
>>562975871why the fuck is the queue so long for rw
>>562985668cute glamcute femralovely smilkethis one's a 10
>>562985648Femra are just fiddies but better
>>562985664type normally or shut the fuck up.
>>562985317May I PM you? Just going to ask you something, sorry if this is ultra sus.
>>562985559>>562985668>>562985752She's a mom.
>>562975871is this right?
>>562985706wait are we maximizing or minimizing the scores now?
>>562985746Can your lalaboy eb's schmeat get past your cheeks?
>shit mood cuz of cc>feel better after taking a walk>play another game and its instant depression againmaybe i am bpd
>>562985808Sure, I'm online right now on lich
>>562985510Make CC the only PvP mode
>>562978589turmeric stained hands wrote this post
>>562985746why does your lalaboy dress like a whore
>>562983498>she barely respondsbro...
>>562985812Moms need love tooare you looking for a father? I'll teach you how to play ball
>>562985861Alright, give me a min!
>>562985864Is this real?
>>562985856i think you just needed some sun and still need some sun
>>562985861Light!
>>562985797Uh oh, schizo meltie
>>562985864>femra gook slopSOULLESS C-C-C-C-COMBO
>>562985510an unironic social link deal tied to trusts where the more story-relevant npcs like you the more likely you'll see them in the overworld during your adventures like prishe/alxaal or alpha/omega. it'd be nice to see the scions candidly doing things around the world like thancred on a "mission" to hit on some dancer or estinien getting ripped off again in one of the major city's trading hubs, and their dialogues when you talk to them would change based on how close you were. maybe they can even give you dyes, gifts, trinkets and unique little cosmetics for fun based on who they are.they're your close teammates, give us the ability to make it feel that way. >>562985579now that you mention it yeah i can kinda get it. im personally a little avoidant, although i wouldn't say i don't see people as people, just kinda a machine going through the motions after a certain point.>>562985664its OVER
>>562983989I'm usually extremely calm, maybe a bit energetic, I'm just retarded and struggle to read social situations on top of a few other frustrating traits to people. I'm better than I used to be thankfully.>>562984310For many reasons this wouldn't happen.>>562985374Care to explain how? Genuinely curious. I don't want to be unpleasant, but I've come to realize my personality is like oil to many's water.
>>562985954npnp, if I'm slow to reply it's cus I'm doing fates as blu>>562985969Home..
>>562985945Nigga. It's a golem.
>>562985740if I could snap my fingers and make it perfect then I think this is the number oneI know people that were endlessly enslaved to that game purely because of the combat, and the only one friend I know that played both(Kirsche who still uses her Elin as her vtuber avatar) still misses it(but not the publisher bullshit lol)
>>562985835yeah>>562985886it's hot, don't need another reason.
>>562986057you definitely need a father figure
long passionate makeout sessions with meiwo
I have melee dps anxiety
>>562986165Dude I'm 24 and own my place.
>>562985494STOP
>>562986146>(Kirsche who still uses her Elin as her vtuber avatar) still misses it(but not the publisher bullshit lol)parasocial shit nobody asked about
>>562986043I want to make you feel like a MAN, Batz
>>562986182Meiwo and Ai
>>562986234i'm giving an example of somebody that loved the game so much that they took their character and made it their entire business-facing personality
>>562985267What band-aid?
>>562986180ah hell no they modding fiddies and femra into re6 menus
>>562986324It's aislop
>>562986043are you actually ftm? do you look like a faggot irl? as long as you don't strip skin from your thigh to form a fake penis made of thigh skin or overdose on testosterone to give yourself norwood 5 i'll be your "friend"
>>562975871I got a 0, I demand a reward.
>>562986234My femlala wants to know more about kirche or whatever it is Berke-sama is talking about…
>>562986279At the same damn time.
>>562986218what you mean is that you pay rent in washing dishes and your mom owns the place.
I'm logging in
>>562985694>Never forget that halmarut invented morbolsjust gonna make it better when i feed her to one in my next Hairymutt scene.
I really am the most average person in the world
>>562986387No one gets mad at you for being the way you are.
>>562986410FOR MY NIGCODED LALABVLL STUDWait a second.
>>562985706No one does that, most internet tests are just terrible and tell you you're mentally ill because they were made by tumblerites who think "getting mad occasionally" means it's okay to get unreasonably mad for no reason because you have some self-diagnosed mental disorder.
>>562986405giga racist rightwing grifterhttps://virtualyoutuber.fandom.com/wiki/Kirsche
>>562986430are you the malezen who always has his cock out?if so im a big fan of yours
>>562986426Nah I haven't spoken to family in five years. I completely cut them off after I ran away from home when I was 19.
>>562985510rival wings roulette
getting a 0 shows you specifically those the "right" answers btw instead of answering truthfullyso you are indeed a bdpdemon
>>562985927What response is there supposed to be? Moonies expect cum on or in them. It isn't even a video.
>>562986319NTA but https://xivmodarchive.com/modid/129600
>>562985510hairstyles on glam plates
>>562986471>no one does that
>>562986490https://www.reddit.com/r/VirtualYoutubers/comments/1kblbdw/a_serious_discussion_about_kirsche_verstahl_and/damn I didn't know berke had based taste in vtubers
>>562986465There can't be two of us in the thread.
>>562986490>giga racist rightwingBased.
>>562986567Uh oh BPDemon melty
Alright enough laughing chucklefucks, make a new fucking thread.
>>562986567>seething that your thread enemy was actually mentally sound unlike youheh
i hid the mental illness anchor
>>562986490she fucks black men tho
>>562985510a proper dump vault so my inventories aren't constantly full and I don't have to pay real money for more retainers to store more stuff.
are femra into ntr
what is it with biofems and personality tests?
>>562986016im sorry twin... im really really sorry...
>>562986535this but unironicallywe have 2 FL maps going on at the same time and it works fine, so why not YoshiPadd it add it add it add it add it
>>562986772Yeah they said racist
>>562986772what's up with you following berke around and posting about blacked constantly? do you have something you want to confess?
>>562986016you're not the 0%, that comment was about korra being loaded
>>562986741>doing thisGood job!>feeling the need to announce you didMiss!
>>562975871I live in the thread endlessly post about parses for thread enemy ebins
did not take the BP test because I already know the resultsit does good
>>562986529you're online eighteen hours a day, nobody asked for your character's backstory, we're talking about you in real life living in your momma's basement melting about trannies turning you down
im... taking my meds........
>>562986892
>>562975871me hrothgal actually isn't that crazy she just has extreme bouts of low self-esteem and pessimist thoughts sometimes
>>562986845I don't care about BerkeKirsche has talked about her love for BBC multiple times on stream and you chuds should know that before you start simping for her as "le based right wing foid"
Fine, I'll do it myself.>>562986931>>562986931>>562986931>>562986931>>562986931
>>562986930please keep your fetish to yourself
>>562986930uhm im a trump voter and blacked is based women deserve to be fucked by animals
hmm...>>562986567I responded 100% truthfully including some stuff that would probably flag but idk maybe the things that are not bpd just knocks the score down to the negatives and the lowest it shows is 0%
>>562975871what a dumb test it doesn't mean anything
>WOAH IS THAT A FEMALE AU RA IN THE STORY WITH GREEN SCALES WHO SAID A FEW AMBIGUOUS LINES>DESPITE NOT HAVING A TIMID PERSONALITY I ASSIGNED IT TO HER AND DIDNT LISTEN TO ANYTHING IN THE CUTSCENE SHE WAS IN
>>562984987>>562985171>>562986849I really hope they make her more autistic than grace ashcroft
>>562975871am i too late?
>>562987047shut up bitch
>>562986535i honestly gave up they'll ever do anything meaningful with rw ever.
>>562987149WUK LAMAT 2 IS WIFE
>>562987047She literally pisses her pants upon seeing (You)
>>562987234She just says some random shit about the witherers and then hides from you. Which doesn't mean much considering you also fucked up the person she's with. She's not even in like 10 minutes of cutscenes to have a personality yet I wouldn't say she's some timid nerd girl.
>>562984375Sexiest moonoid here ngl
>>562987147this is a cute fiddiehello ma'am can you show me where the nonfiction books on rocks are...
>>562984976im not wife material
RIDING SIDE BY SIDE UNTIL WE DIE
>>562983383
>>562987703That's what you thinkand yes I know who this is
>>562990321>and yes I know who this isNo i genueinly just dont think im good wife material lol
>>562991383You can think that but
>>562991667you say that until i spend one of my days off having a hysterical argument abotu inane bullshit in a server
>>562991869That's far from the worst thing I've ever dealt with
>>562992081ok sure whate ver but im 99.9% sure you dont actually know who i am
>>562992379Ahmea
The plot thickens.
>>562992482hA! wrong hroth!
>>562992864Off just that one angle you can see how you two are very easily mistaken, especially when fully clothed
>>562993538no that is me I was fibbing, sorry.
>>562993985dork
>>562993985Become that anon's wife as an apology.
>>562994523>>562994726my bad
>>562995521Taking 1 smooch as an apology
>>562995632but idk who you are...
>>562996734A male hrothgar with similar fur colors will appear without warning specifically to ask for that in the future