he got the 'tex posted

>>219512830
looks like Elden John farted on it

>219512693
the uygher genocide is utter bollocks and taiwan also doesn’t recognise the prc (or mongolia) as a country

fucking hell get a clue

any of you lads preparing for Race War?

get the sodding 'tex posted

i am bored and lonely and everyone is mean to me

>>219512780
it's so obvious his story is a complete fabrication but the fact that somebody bothered to invent such a boring, mundane, pathetic character and obsessively plays them every single day is even more repulsive than if it were real

See the luck I’ve had
Could make a good man turn bad

>>219512860
go to the gym

When was the last time someone IRL told you that you're funny?

>>219512854
yh I’m bringing my Mazda MX-5, should be able to get through to the later rounds and set some good times

>>219512865
why

File: 1761746183844935.jpg (518 KB, 1362x2048)

518 KB JPG

>>219512856
ok i will!

>>219512860
That’s the story of my life

I don't understand escortmong's attachment to this one escort. He keeps saying it's because he lost his virginity to her
I lost my virginity to a fun-time lass, one night stand type thing (or 24 hour stay over at my place). I knew it was just a fling and didn't develop any attachment.
I didn't get paranoid about stds.
immediately after and pestered her about in the weeks after which makes me cringe but she took it well desu. Funnily enough I made a mate a few years later who told me he also developed an irrational fear of stds after losing his virginity and did a full battery of std tests (as I did). I think it's hyperchondria or autism or something.

>>219512860
well that's a lie

>>219512854
Got my snacks read, I'm just going to watch it on the telly

>>219512860
i'm bored and lonely no one is mean to me. i'm usually mean to every one else. which is why i'm bored and lonely

>>219512891
its one of spakis gimmicks

File: 0004ee45-17ca-3aa7-0ea0-3(...).jpg (87 KB, 350x796)

87 KB JPG

>>219512856

>>219512907
how so
you are always mean to me and so's the other one (even moreso)

>>219512929
i'm not even that mean to you you just frustrate me sometimes

>>219512891
*machine guns you to death against a wall, your dying body flopping around like a fish as round after round screams through your flesh*

>>219512798
how are you with upgrading mobile phones? im really bad and keep the same phone for ages out of habit and dreading having to switch everything over to a new phone. even though now i think they make it very easy for you to transfer files and apps over to a new phone. I still fear it.

imagine being bullied at work
like having some bloke there that you dread to see every day, who goes out of his way to fuck with you
mental that it actually happens
wwyed(what would you even do)

>>219512862
Adult men playing make believe on the internet and clinging on to the most cringe narratives possible. Grim.

imagine actually believing in a uygher genocide or that the maidan coup wasn’t initiated by the cia. like are you retarded, or just an acolyte of jeffo epstein?

Going to shower soon need to just get it over with instead of putting it off

the weirdest thing is when you half-heartedly sit down on the toilet on a whim not really expecting muh to happen, then masses of shit suddenly start pouring out of your anus. it always leave me in astonishment

File: 1765197446703955.png (2.05 MB, 1920x1080)

2.05 MB PNG

Ha ha ..

Gary Eats !! You Are
great

at

Football

commentary .. Like John Motson ..

>>219512945
yeah i don't like doing it
you can do it in the shop i think

>>219512974
wash behind your ears!

boring, catty, mental, needs a brick thrown through their window
just a few of the many mean things you've called me

>>219512891
its not real
his story has changed multiple times
he saw the escort "for the first time" multiple times weeks apart
he asks the exact same questions over and over again even after people give him the same answers
he made it all up

Might make a Twitch account

>>>219512786
how did you screw up with test and get gyno?

>>219512974
Talking of men playing make believe on the internet

Tottenham cakes are great, I've eaten them all my life (a London boy you see)
They're similar to the fairy cake slices with pink icing on top that they served in school

>>219512927
whomst

>>219512976
sounds like you're literally driven by instinct and have a lower level of consciousness than the rest of us
possible fertilizer candidate

>>219512959
smash the cunts face in

>>219513014
>fertilizer
FOY

>>219512976
when i eat like shit my shits are all sticky and it’s hard to wipe. when i eat healthy i barely have to wipe. only reason i eat vegetables desu

never called you boring
the others though yes
mostly in jest though!

>>219512992
>he asks the exact same questions over and over again even after people give him the same answers
to be fair that's not unusual with runts like him, ruthmong does the same thing
i do hope it's all fake though because it is genuinely mental and depressing if he's for real

kill jews... IN REAL LIFE

>>219512984
Are you into gaming or nah?
With gaming I'm the same as with computer, just not interested. I'm not sure why.
I enjoyed playing PS1 and PS2 and then just stopped there. Never been interested in gaming since.

fuck off yes you have

>>219512989
>>219513023
>>219513037
this conversation could have been had over discord

File: 0004fa85-f74a-504b-39c1-d(...).jpg (196 KB, 580x800)

196 KB JPG

>>219512856

Do you lads go to live concerts

File: file.png (177 KB, 412x367)

177 KB PNG

i'm sure to win

>>219513054
yeah
don't really like them as much as i feel like i should

>>219513036
I stopped after ps1 and never went back
I don't like gaming, no

>>219513037
ok i genuinely didn't that's the other one

File: 1771759776315609.webm (2.5 MB, 576x1024)

2.5 MB WEBM

love them

>>219513054
i've only ever been to Katy Perry back in 2014. i bought Offspring tickets last year but couldn't be fucked going lol

>>219513043
freeloading little bastard no wonder rnhs is going down the tubes with timewasters like this taking up space

I've been listening to this song nonstop ever since hearing about that story last week of the AI bot that wrote a seething hit piece about some guy on its own blog and now I see Daft Punk have released a video for it the song is ancient
https://www.youtube.com/watch?v=UsXubuXq1lM
I'm scared now

>>219513057
ktim with the inpost lootboxes where the grand prize is a flat

As a millennial who isn't that interested technology and is happy to use old laptops and mobiles, I think I would have struggled growing up as a zoomer.
In millennial times, the only thing you had to worry about judged on were your clothes. Now you'd be judged on what phone you have, how many followers and likes you've got, etc.
And don't get me started on the haircuts. Millennials didn't really have a fixed hairstyle for boys, you could just get it cut how you wanted. The normal haircuts were plain and boring. Hair gel was optional.
If a zoomer doesn't have the brocoli haircut, I'd imagine they get ostracised pretty badly at school.

>>219513081
want to shag her face

remigration now

>>219513110
*their

ok keep ignoring me

>>219513126
i replied to you mate? wtf

File: Screenshot 2026-02-24 225844.png (549 KB, 1425x671)

549 KB PNG

this is sad you know
His wife dies, he loses his best friend Catherine O'Hara a few days back, and now he's only gone and lost his daughter.
To sudoku no less.

Hopefully Meryl gives him a shoulder to cry on.

There's usually a bit of toilet paper already inside my toilet so when I go to poo it lands on the paper which is like an island and doesn't get submerged in the water so I can smell the poo really strongly

>>219513126
the other one called me boring and you agreed then called me a mean person
bye

>>219513119
never gonna happen

>>219513135
don't care

I can't believe the actor who played the dad in Lizzie Maguire just killed himself

>>219513155
because you were mean to me

>>219513145
tried using a flush

discord drama again? very boring!

File: til it.png (43 KB, 216x166)

43 KB PNG

https://www.youtube.com/watch?v=u_JNpPN7Dfo

>>219513135
bitch done blown her head smoove off

>>219513180
the worst part is that i quite literally did nothing!

>>219513145
Who is leaving the toilet paper in there

File: IMG_0534.png (164 KB, 498x447)

164 KB PNG

>>219513180

lizzie maguire is the best kubrick film

so yeah not really surprising that the most evil countries geopolitically are run by people who eat babies

zilean fast

need to dispose of a collection of empty rum bottles currently stashed under my bed

>>219513225
recycling

File: IMG_3589.gif (1.34 MB, 220x321)

1.34 MB GIF

>homer bimpson

white people be like Eyes Wide Shut is my dogs favourite Kubrick film

File: max chill.jpg (174 KB, 1125x633)

174 KB JPG

+1 I support this edish

>>219513207
I do. I always put toilet paper inside the toilet and don't always flush it away. I even put paper in there before taking a shit as it prevents splashback. Just too much sometimes, and it creates a poo island above the waterline.

August 16th, 2002.
https://m.youtube.com/watch?v=7e9NX60dXJ4&pp=ygULaWFuIGh1bnRsZXk%3D

>>219513240
kek

no sexy ponies

File: img_240226_230526.jpg (195 KB, 1080x1440)

195 KB JPG

let's FUCKING go

File: 469901188_182744611602471(...).jpg (386 KB, 1440x1440)

386 KB JPG

>>219513247

That’s pony content outside of /mlp/ now isn’t it

File: Screenshot_20260224_230712.png (966 KB, 907x788)

966 KB PNG

Right well that's Obama eliminated from the Boshin War isn't it

I'm sure i didn't imagine a porn channel where the guy wore spyglasses and recorded sex with women. It was porn but he pretended he was secretly recording them. This was some time in the late 00s

they can be posted

>>219513180
thumbnail looks like a tranny shooting fat ropes of hot sticky cum from her thick cock

Sleeping in my bed

>>219513302
it's not that thick

>>219513290
great game got a fots camp going now

quite skinny actually

>>219513291
Porn is immoral and unchristian, I suggest you wash your hands of it all together.
Lent is the perfect season to do so after all.

>>219513305
ktim

File: 1607685813931.png (45 KB, 652x518)

45 KB PNG

>>219513283

>>219513305
leftypol throwing his phone in the air, screeching, and stomping off up and down his bedroom at this post

Wild to think that less than 1% of black and brown people living in the country have an ancestor that lived here in the 1950’s.
Everyone over the age of 90 are white, and everyone under age of 9 are brown.

you all bent for lent?

considering a THIRD cup of tea for the day

>>219513311
>>219513326
ummers

>>219513337
The woke mob trying to ban sleeping now are they? Thats leftypol for you

>>219513340
So what?

are you mad at me? :(

>>219513043
horrible rat needs punting out of the door

>>219513340
>everyone under age of 9 are brown
my new cousin isn't brown

>>219513354
We had more immigration last year than all immigration from 1066 to 1945

>>219513287
not that bad/10

>>219513340
Yes it's mental
It happened so quickly

Had one of those split steam pisses, it was messy. Dry by morning or mummy will clean it

>>219513043
omg :3

turgid willies

>>219513372
So what?

>>219513376
alri norgebro whats up with your PM and King deciding to unalive themselves

right well that's me playing against a mundo support in ranked isn't it

>>219513371
My 2 nieces are half black, and me? I’m childless, frog posting on 4chud hehe

>I've met funny Germans
>I've met cunty Canadians
>I've met non-pretentious Frenchoids
>I've met intelligent yanks

mental that stereotypes are utter bollocks
except for stereotypes about brown countries. they're all correct.

>>219513397
alri tory malteser #24

sent a message to my black friend

>>219513366
Your shits fucked now boy

>>219513402
misah worlwy

I THINK I JUST REALIZED SOMETHING, AND I MIGHTVE MADE SUSCH A HUGE MISTAKE

The winter olympics are great because it's just people from nations with an average IQ above 100 playing in the snow and having fun

>>219513135
literally can't imagine anything worse than that

Do you have a best friend?

File: POW_POW_3232-001.jpg (119 KB, 944x677)

119 KB JPG

I was only a kid in the 90s, but you felt that the country was still solidly white and that whites were still firmly in charge of everything. It felt reassuring.

Imagine how peng it would be if only european nations existed

>>219513305
should have donated your room and bed to syrian refugees

>>219513447
nah. of my 3 friends, 2 are best friends with each other and the other one has a completely different best friend

>>219513450
This + women knew their place

>>219513453
>no full english
>no st george
you've done yourself there rorke

right thats me steaming on a work night
might have to pull a cheeky sicky

>>219513450
We unironically had ZERO Muslim MP’s in the 90’s / early 00’s.
We now have 25.
Says it all…

>>219513283
Triple stack monster burger that's based

>>219513400
just wasted 48 minutes of my life
not worth it

Bear Grylls apparently just found out about the rape gangs and his first thought is 'surely the police are onto them'
How fucking out of touch are all these celebrities?

https://x.com/BearGrylls/status/2026339714278601101

>>219513453
wouldnt be peng, how are young european men supposed to go on exotic adventures

https://m.youtube.com/watch?v=fbOM12ziMNA&list=RDfbOM12ziMNA&start_radio=1&pp=ygUYQnJhaW4gc3RldyB2bGFjayBnYW5nc3RhoAcB

Even in the 90s there was fairly few wogs

67E Possession or publication of pornographic images of sex between relatives

(1) It is an offence for a person (P) to be in possession of an image if— 107Crime and Policing Bill

(a) the image is pornographic, within the meaning of section 63,

(b) the image portrays, in an explicit and realistic way, a person (A) sexually penetrating—

(i) the vagina or anus of another person (B) with a part of A’s body or anything else, or

(ii) B’s mouth with A’s penis,

(c) a reasonable person looking at the image would think that A and B were real, and

(d) a reasonable person—

(i) looking at the image, and

(ii) taking into account any sound or information associated with the image, would think that A and B were related, or pretending to be related, in a way mentioned in subsection (2).

(2) That is to say, A being related to B as parent, grandparent, child, grandchild, brother, sister, half-brother, half-sister, uncle, aunt, nephew or niece.

File: IMG_0007.jpg (221 KB, 1151x1521)

221 KB JPG

She shits at least once a day.

>>219513305
You're such an interesting person

>>219513492
just play aram mayhem
waste all the same time but with none of the stress

>>219513340
ermm we're a country of migrants sweaty x

give me attention please i'm sad and dysphoric

>>219513495
incredibly out of touch. decades out of step with the native population

>>219513508
not everyone has a daily poo. a scatological expert such as yourself should know this

>>219513485
Funny thing is everyone knew it would happen but didn’t correct course.

File: IMG_4811.jpg (45 KB, 450x681)

45 KB JPG

>>219513472

watching an autism youtuber and they jumpscared me by advertising a sex toy

>>219512813
Is this an old photo of her? If not, it seems to me that she looks younger and younger every year

fggfhffdfhgfh

>>219513519
what's your favourite album of allllll time?

>>219513503
ok for pakis to marry their cousins and shit out inbred money sinks though

>>219513519
what a loser

rorke holding bear grylls into a headlock and forcefeeding him redpills as we speak

what i don't understand about the mass invasion of the UK is that you're an island AND have a whole continent full of other countries between you and the brown hordes
other countries that are happy to hand out welfare to any and everyone

the US was fucked no matter what due to the massive land border with brownoids, but you niggas have no borders

crying and the downstairs neighbour is going WOO

>>219513519
same

File: metwat.jpg (319 KB, 1920x1080)

319 KB JPG

>>219513508
Emma Watson is so mid

Also hello

>>219513540
When the Pawn Hits the Conflicts He Thinks Like a King What He Knows Throws the Blows When He Goes to the Fight and He'll Win the Whole Thing 'Fore He Enters the Ring There's No Body to Batter When Your Mind Is Your Might So When You Go Solo, You Hold Your Own Hand and Remember That Depth Is the Greatest of Heights and If You Know Where You Stand, Then You Know Where to Land and If You Fall It Won't Matter, Cuz You'll Know That You're Right

>>219513527
This was before pre-woke

actually i think i like The Idler Wheel Is Wiser Than the Driver of the Screw and Whipping Cords Will Serve You More Than Ropes Will Ever Do more

think i'm going to start spending less time here and will start going out into the real world to find things to do. this can't be all there is to life

File: IMG_4802.jpg (83 KB, 946x696)

83 KB JPG

Got a job at the Home Office

File: 1580830756236-TEENAGE_BRE(...).jpg (480 KB, 1920x1080)

480 KB JPG

What happened to these Brazilian sisters?

File: 1000_F_885873717_sZTCusAP(...).jpg (462 KB, 824x1000)

462 KB JPG

>>219513519
Funee munkey :))

>>219513564
>>219513581
me too

>>219513554
you ok? :)

>>219513550
The three people who enabled the invasion were Peter Mandelson, Jack Straw, and Barbara Roche.

Any guesses on the ethnicity of these New Labour architects…

>>219513563
arrogant brown fuck

>>219513550
I’ve been asking myself the same thing for the past decade and I’m still not sure what the fuck is wrong with our ruling overlords.

>>219513595
yeah just playing the sims u?

>>219513609
played some fantasy life
reached master rank in fishing and farming :>

acually steaming i'm fucked what is wrong with me ive got work in 8 hours

>>219513563
later that night she probably rubbed her minge silly while fantasising about white blokes shagging her rotten

Right well that's my ip address isn't it

>>219513586
They were MI5 agents which is why they've pretty much vanished.
https://www.youtube.com/watch?v=V62kLvDj2Jg

>>219513614
the universal human desire to do fish minigame

quite depressed and bored

>>219513485
>The House of Commons is an elected body consisting of 650 members known as members of Parliament (MPs)
wow 4% of mp are migrants its over bros uk has fallen

Why is he hacking IPs in this thread ;_;

yeah best place to put a spy is all over the tv and internet

chopping trees to farm logs to make furniture to level up my carpentry to make a better axe to chop higher level trees to farm logs to

I heard even normies are getting pretty racist now wouldn't know myself as I don't go outside you see

There's a lot I don't get about mass immigration to the UK. Like how do these millions and millions people in third-world countries apply to come here? Because 99% of them come here by plane, not by channel crossings. It's all arranged with the UK ahead of time. What if the UK just said no, sorry, we're not taking any more?

>>219513645
watch this I got your genetic code
gcgucauggcagcagucccugaggcgcguggcgucucguucucauacuaucgucgauccguacagcgucgcgcgcgccuauauucuucgucugccucuccgagagagcagggagcggggcgagacgacucgaucguaguaaucgcuagcaucgaugcgucauggcagcagucccugaggcgcguggcgucucguucucauacuaucgucgauccguacagcgucgcgcgcgccuauauucuucgucugccucuccgagagagcagggagcggggcgagacgacucgauc

>>219513668
*hangs you from the highest spire of the tallest tower of waterloo station*

the october revolution was based and tarqs should be executed en masse

>>219513668
That’s just the Muslim ones.
Plenty of blacks, browns, mutts, and indians.

Ofcum

>>219513674
>normies
Unc

yeah?
192.168.0.1

>>219513685
it's gcat for DNA
gcau is for RNA
made a bit of a fool of yourself here haven't you?

>>219513684
It's ethnic cleansing of the British isles
They aren't incompetent they're evil

>>219513695
fucking UM

A ceramic is any of the various hard, brittle, heat-resistant, and corrosion-resistant materials made by shaping and then firing an inorganic, nonmetallic material, such as clay, at a high temperature.[1][2] Common examples are earthenware, porcelain, and brick.

File: 1771963490005885.jpg (143 KB, 1080x1440)

143 KB JPG

https://www.youtube.com/watch?v=aCmtbciKbHI

>>219513710
didn't say it was dna did I tho

File: IMG_4807.jpg (212 KB, 959x1279)

212 KB JPG

lol

Started praying to Jesus to save me from temptations and so far I've managed a week without staring at birds arses so I think it's working.

Goodreads readers select "The Hunger Games" as best book ever

>>219513689
>the english got a station named after waterloo
cringe af

atb soon

>>219513674
have you heard of the high elves?

File: IMG_4808.jpg (154 KB, 959x720)

154 KB JPG

Boy semen

>>219513685
me sucking a cock

>>219513739
Yeah from Skyrim

havent bit my nails in well over 2 weeks but they still look like shit :(

>>219513744
genestealer

The late 00s were a strange time in regard to what you could still be said. I remember having a conversation with two female uni flatmates, one was a left-wing, white art student and the other was an Indian girl.
I felt comfortable enough to tell both of them that there were too many immigrants in the UK. The left-wing girl AGREED with me, as did the Indian girl. There was no awkwardness. The left-wing girl then complained that her small town was being overrun by immigrants. You could openly say things like this and nobody would call you a racist.

what percent black is this
https://www.youtube.com/watch?v=otSDpzH86mY

Mastermind
Black

University Challenge
Indian

Weakest Link
Sri Lankan

The BBC truly is the world service

>>219513731
that must be a record in france. i know your lecherous kind

Do you get to the cloud district very often

you lads consider yourselves more of a Frasier or a Niles?

>>219513749
they'll heal keep it up you're doing great :)

File: file.png (794 KB, 767x1023)

794 KB PNG

>>219513730

File: 1693077914649.jpg (57 KB, 553x490)

57 KB JPG

>Martin Short's daughter dead at 42: Only Murders in the Building star's eldest child dies 'from self-inflicted gunshot wound' in latest tragedy to rock beloved Hollywood legend

>>219513766
we here at /brit/ watch old Jeopardy episodes on youtube

>>219513779
:>

>>219513764
um

>>219513785
For me, it’s Michael Portillo’s continental railways

>>219513402
never understood why youd see us as pretentious considering this country is full of simpleton retards

>>219513764
if dancin' on ice what she wanna do

I can’t handle no liquor

>>219513798
right well that's not a game show is it? fool

hi

File: Screenshot 2026-02-24 234137.png (523 KB, 625x893)

523 KB PNG

oh my DAYS

>>219513563
better if you just leave the country now love x

File: stg-prince-andrew-newsnig(...).jpg (183 KB, 2500x1407)

183 KB JPG

>>219513785
>it's an Alex Trebek says "no that's not right" episode

>>219513764
why is she coloured so weird
what happened to her rainbow

>>219513816
vile decor

>>219513816
Err

File: french wojak.jpg (10 KB, 238x212)

10 KB JPG

>>219513801
it's your stereotype init
The moody frenchman who makes a black-and-white art film whilst wearing a beret and overalls over a white shirt whilst looking depressed and smoking a cigarette and who bullies people for attempting to speak his language (including quebecois)

>>219513816
hate this retarded ahh timofee

File: 1770752047734867.jpg (744 KB, 2625x3281)

744 KB JPG

https://www.youtube.com/watch?v=N541HLPeG6Y

File: photo-output.jpg (238 KB, 2046x1148)

238 KB JPG

Tracy Emin was cringe and gay

>>219513831
its so cringe though

starting to think nothing will bring me happiness

bit annoyed that we don’t have access to the sort of liberty our ancestors had when it comes to women and dating

>>219513816
phwoar no way he aint put his dick in that

LUSH

>>219513838
I just don’t understand this Tracey Emin art

love you

who are you lads voting for in the by eleciton?

>>219513847
what if you had a guy who did wavey hands while moving from foot to foot

>>219513838
>was
she's not dead yet

Will never own a home.
Will never have a family.
My taxes are being used to give welfare to foreigners and single moms.
Legal system handsomely rewards breaking up families.
Legal system criminalizes lots of normal male behavior.

I have ZERO stake in this society and would gleefully watch it burn.

>>219513838
was this based on her actual bedroom?

>>219513122
you know there's not actually two of them right?

I am shite

File: G9288l4XgAAmIDv.jpg (32 KB, 480x528)

32 KB JPG

https://desuarchive.org/int/search/text/understand%20this%20Tracey%20Emin%20art/

>>219513858
greens

>>219513838
snapshot of a smelly bedroom by Tracy Emin

Do I wank tonight or wait until I can shag the gf and inevitably spaff almost instantly?
Hmm choices

>>219513871
ah yes the accelerationist voter very shrewd

i'm being ignored!

>>219513868
It's a Harry Enfield reference, of course it's been quoted many times you mong

>>219513886
fuck off

>>219513862
>moms

would gleefully watch you burn

File: wtf.png (438 KB, 703x781)

438 KB PNG

may I say something retarded
I was coming home from toil today on the train, and there was a girl in my peripheral vision. She looked pretty from the periphery, hair done and make up and the like.
I glanced at her when she wasn't looking and she was terribly unattractive.
Big forehead and big jaw, looked like one of those toy babies that had been punched in the face.

It made me so sad. She clearly put in quite an effort into how she presented herself and it was all pointless.
The life of an ugly woman is such a bitter one. Women are so defined by their looks. At least an ugly bloke can make something of himself, be funny and the like.
idk it just made me sad.

blog over

feel like shit just want threadmeister back x

>>219513837
I'd chain him to my bedpost and use him as my personal fucktoy

>>219513896
fuck off

https://www.youtube.com/watch?v=Ihd2Nj7sFfo

>>219513907
her*
but same

>>219513798
Pour moi aussi, mais il est espagnol

>>219513914
canadian

File: photo-output.jpg (547 KB, 2046x1556)

547 KB JPG

>>219513838
Her other famous one is “everyone I ever slept with”. Her work is absolute dogshit. and she’s an utter cunt.

>>219513914
Can I join if I’m brown?

horse

Dorton and Genton by-election 8/15 greens to win 2/1 reform to win according to the bookies
it's over

>>219513914
>join our Honeypot discord
first day on the job gchqlad?

>>219513931
If you will suck my bwc then yes

>>219513944
what does that mean

File: Screenshot 2026-02-24 235157.png (98 KB, 1278x773)

98 KB PNG

>>219513914
lol

>>219513914
haven't seen are rupe tweet about this

>>219513955
you're a nut
you're crazy in the coconut

horse

Just seen advertising or begging

cant wait for labour to win because white folk are vote splitting cunts

>The Independent newspaper reported in August 2010 that Emin is thought of as a supporter of the Conservative Party.[219] This was confirmed in an interview with New Statesman, where she revealed that she voted for the Conservatives at the 2010 general election, adding, "We've got the best government at the moment that we've ever had."[220] She has stated that she is an 'outsider' in the art world, as a result of voting Conservative. She is a royalist.[221]
bizarre, did not expect that

>>219513959
"we are here to shill and brainwash our users"

>>219513944
Reform have more silent voters

Greens have more virtue signallers that fill out polls

What sort of cunt you have to be to spend 10 minutes doing a questionnaire / poll

>>219513971
reform winning is the same as the green party winning so wouldn't really matter would it
though I could be wrong, I'm just a dumb yank

Boomers saying one last don't be racist before dying and leaving their descendents an impoverished Muslim shithole

>>219513975
why? rich twat artist

>>219513983
gigacope

snapping my cock in half

File: G4TVaByWoAASdex.jpg (79 KB, 1016x1033)

79 KB JPG

aff tae bed

I'm voting for Walt Disney!

>>219432514
>>219432514
>>219432514
>>219432514

>>219514007
dont bother waking up

>>219514007
good night arianabender

Whites over the age of 25 that vote green or labour are Whites that got bullied by Reform voters at school.
It’s that simple.

>>219465795
>>219465795
>>219465795

>>219514020
disgusting thing to say

>>219514020
bit rude

>>219514022
nini

>>219514025
Cope on
Normies are all voting greens because of the "tax the rich" slogan

sir john new

>>219513983
pretty sure the pollsters are aware of this

NEW
>>219512911
>>219512911
>>219512911

>>219514033
why? the mf always come back an hour later. i want AH to sleep through the night for once

>>219514035
If you’re Jewish and got bullied by a council house chav for 13 years of your life I somehow doubt that you’re voting reform.

>>219513959
i wonder how many will be stupid enough to let themselves get doxxed this way

love the whiffs of poo when i shag the bf's hairy arse

>>219451274
>>219451274
>>219451274

Are we just not having a new then

it's the gimmick that keeps on giving

none of those link to a new thread
one of them even linked me to a Chilean tranny

POO HEAD

LMAO