WEREWOLF Thread
>>37707189we already have a thread OP >>37671832
>>37707381More the marrier
>>37707387aawwwooooooo
>>37707189Lets kill all of the evil together lest i smite all of you. Now like phinehas
It is good for brothers to dwell together in peace
yip
>>37707434What do u want
>>37707443in what context is this question?
I welcome the werewolf threads, all the vamp threads filled with larp fangs
>>37707454All of the context i legitimately want to know what you desire and am not trying to be rude i apologies
>>37707463I...idk sorry
>>37707189They ain't real buddy
I hope there isn't a furry in my thread...
>>37707484Ok thats ok just curious. I would be freaked out if u said something else
>>37707518Yea you aint real
>>37707533I'm not a werewolf so that's not a problem for me
>>37707541Thats just what a robot would say. How clever
>>37707541You are like 80% not real
>>37707547Nuh uh. And I'm not a vampire either. So don't bother accusing me.>>37707549Rude
>>37707553Same thing happened in my dream. I said hey im dreaming and dream people lied and said i wadn't
What if god actually only made one other person
>>37707400you can kill those two having a nothingburger argument
See how yer logic falls apart. Yer fake
>>37707577Thats why this is not real: you are irrational. *mic drop*
>>37707585Nothingburger, come back to me when you get some hapeningsauce
>>37707589No i dont believe you exist you are extraordinarily irrational
>>37707594I don't mind that you don't believe, I am however bothered by there possibly being a furry here
>>37707605If you were real you would mind it
I think you are fake and you got me to agree to this false reality because i am nice. This is all bulllshit and its obvious
>>37707189>WEREWOLF Threadvery simple to become, CRISPR gene activation of old transposon system crica Z17ACCGAGGGTAGATGCGCGCTACTGCCCGGCTCTACGTAGCTACGTACGTGACTGACTGGCTABLAST it, see where it takes you
>>37707655How ridiculous
>>37707624They are real bro
>>37707189I had just had a dream where I had a romantic encounter with a wolf man but I was mostly scared because his teeth were really sharp and strong and I was scared of them but I still wanted to be romantic with the wolf man but his sharp teeth made it really hard plus he was really cute
>>37707605You are definitely a Furry.
>>37707189God, I want for a werewolf to pin me down and hold me in place as he tears apart clothes and brutally rapes me. Ideally, a whole pack of werewolves.
>>37708398>>37708400>>37708407craziest blunt rotation
>>37708407fuck
>>37708452Exactly!
>>37707189Are all these damn furry threads because the elites are feeling the damn Furries Aryan spirit awakening or something, because if that's the case you feds need to go and start locking the woods down because pretty soon we are going to have actual beast men walking around and it's your job to clean it up, we pay you tax money to fix that shit before it gets out of hand. Get off 4chan and Get innawoods so we don't have to deal with beast men, feds. Please and thank you.
>>37707411To be a Monster of Godhttps://www.youtube.com/watch?v=c_PhcFFjrYA
>>37708730What
>>37707411based
>>37707189Thread theme:https://www.youtube.com/watch?v=WeLFMliNTNkI made this video btw X)
I'm kind of curious, there are currently two active werewolf threads and in the past month there have been multiple therian threads, is something happening?
>>37711829Not very many people are actually therians so they make a furry larp thread instead.
>>37711875at least they are straight
>>37711910I'm really gay lol
>>37711953oof
Funny enough my mental barriers manifest in some sort of wolflike rage, I have been attacked I my dreams and Astral proyection, I have faded memories of ripping apart these negative entities and running and jumping in fours, when I feel their malicious energy rather than cower in fear, I'm flooded with murderous rage. They leave me alone.
>>37712254Anon, they feed off of rage.
https://www.youtube.com/watch?v=sAm8QoSyA6A
>>37712306peachfuzz uwu
>>37707189More like wereWIFE thread, know what I mean?
>>37707411https://www.youtube.com/watch?v=6alkKSaI9EQ
>>37713125Sometimes it's great keeping your thoughts to yourself, I would know
>>37713209Bros larping as a pokemon
>>37713801I'm not your bro
where can i find a pack to chill with
>>37709911They know what I'm talking about, it's ok, you don't need to know if they do their job.
>>37707541That’s what a werewolf would say
Had a werewolf with glowing yellow eyes visit me in a dream.
werewolf gf
>>37714686your werewolf gf is hiding within your walls, you gots to knock them walls down nigga!
>>37714134That's what a werewolf trying to accuse someone else of being a werewolf would say. Stop projecting.
>>37714291same anon, mine is sorta like op pic, but more misty / shadow like, yellow eyes and white teeth with that twisted snarled face, never hurts me tho
>>37716564>>37714291oh, and i forgot to mention i see it when im awake / half awake too(like once a week), its like a sleep paralysis demon but, uh, more horny, dont wanna go into details
>>37708730do you think werewolves are part of the half animal hybrid Nephilims ?
>>37707189do NOT seek the werewolf tapes. fucked me up for years
>>37718795i just searched this and all i found was gay werewolf furry bondage pictures
>>37718800a former friend showed me it around 2010-2011. seriously fucked up, i hope it was fake
>>37719274What are they?
There is a show about anomalous people, ghost and so on an german TV. Was translated but in origin us or UK. There was a show about a African boy that howled, stretched its back, bend over, screamed in pain (all on camera), different channels Interview that boy too, - and somehow he got very long teeth (like an vampire, therefore they called him the vampire boy from Africa). But like his back stretched to nearly breaking, his pain and afterward total... Yeah like.. "im total empty and have to sleep... Im out powered"... That boy is an werewolf. He even showed how his teeth went from normal to super long and very pointy and sharp. I played frame by frame (was on YouTube, downloaded it, was years ago), and what the camera guy and the team of this show seemed to make it up as an "mysterious - but propably scam-story" not seen, obviously, is, was, that the teeth really grow inside his open mouth. He even joked with that in front of his friends cause he was some of a spectacle in his little village and had to do it everytime people asked for. You know.. For.. Amusement.That boy, like maybe 15 was in total pain in that event but OK afterwards.
>>37719349if you still have it anon, can you make a webm?
>>37707454vampires are more gay
Ayo deez mf spooky af. Why yall wypipo go in da woods n sheeit. Dis mf jus be waitn fo yo ass
>>37719274Got a link?
>>37718800Got a link?
>>37721014wypipo wanna fuk dat
>>37714134uwu
>>37719896Sadly no. Could find the docu but it was a german translation of a US show, similar to ancient aliens and all like that.But I found a short vid, picrel. I won't go on TikTok, so it's up to you I guess.. Sorry..As you see I had too search "vampire" but it's definitely a werewolf. And this vid is only a 1 minute clip, the original was a 15 minutes docu about him.I don't know if it's the exact scene (slightly from the side, he shows more of his left cheek while opening his mouth letting his teeth grow). Frame by frame you see it's not a fake. Of course, I'd you just look quickly and know it's a poor boy you would think it's fake to make money.But.. As said.. There is a much longer vid out there.. With guys interviewing him, and him showing it to his buddies etc.
>>37725570Aah one thing, if it was confusing: Picrel of my former post was a visited link, I clicked it, but, I won't make an account on TikTok just to look one video that is nevertheless a short one.. :-/
Yo this thread funny asf
>>37723328Yes.
imagine the smell
whose a good girl??
>>37732703Is mal0 real bros
>>37707189>Wake up>need to go downstairs>see OP picwhat do /x/?
>>37734771fuckin abos broke in again
>>37734800typical coons
>>37732703need
post some bloody dogman greentexts fore I piss meself
>>37707434>>37712012>>37714686>>37732703Custodian of /x/, please move this thread to the /trash/, thank you.
>>37708407this but the werewolf is a girl
>>37736733with a physiology like a hyena?
>>37736746PERHAPSpost hyena
>>37736752alpha female hyenas grow out their clits and peg lesser males
>>37736760that’s gay
>>37707189i dont know what it is about the op image but my mind registers it as a chick, and it’s turning me on
>>37736888based
>>37736888can’t believe this got trips
how to LoA werewolf gf, there is no LoA general
>>37707189Damn, what a dump. Why can't werewolves live anywhere nice?
>>37708407Just like that.
>>37737967too hot for /x/ settle down anon dayum
>>37737967wish that was my pov, does it make me gay??
I'd think realistically you'd die of exhaustion if it was 14 werewolves
>>37738768most of them would just finish on you
>>37738815>>37738768Nah, you would survive because at some point you would contract lycanthropy like a STD and transform.If it strictly has to be a bite, I'm sure a few of them will get nippy with you anyways
>>37738844How do you summon a werewolf gangbang?
>>37738844become the were-whore
>>37738989Imagine being the new one in the pack, the absolute permanent bottom on the hierarchy
>>37739031hot
>>37737967Bruh
>>37707434yiff in hell furfag
>>37739845werewolves are not furry
>>37707189I had a dream a man with goat legs who claimed to be the god of forests and monsters turned me into a wolf
Shut the hell up
>>37740989Back to /vp/ and the gooner rp /pmd/ threads with you.
>>37741006said the pot to the kettle
>>37741243Yeah, how do you think I know anon? Also the Lycanroc thread sucks ass. :^)
>>37741248Hell yeah it does
>>37707189I used to be a werewolf, but I'm alright nowuuuuuuuuuuuuu
>>37736888Trips of truth. Female werewolf with hyenid pseudopenis confirmed.
>>37742253totaly str8 tho rite?
>>37707434cringe
>>37742972we don't care about that shit around these parts bro
>>37725570so somehow the tread is about werewolfs but nobody want to see a vid about it.i WONT make a webm about a almost 15-30 min vid - this one is what you get for free so to say. But i dont see any answer"wow. thats what /x/ is now.. a bunch of pickers - if its not served on your table you acting like rick stubborn kids... sad.
finally somewhere i belong
Werewolf gf AND bf
>>37746839This. So much this!
>>37707189doggy :D
>>37746839you watch and play with the puppies?
>>37749865fella is hungry, just let him have a piece of cheeseburger
>>37751072Does chocolate kill werewolves if they consume it?
>>37744677werewolf titties
>>37708407God yes need a werewolf daddy or futa mommy to ravage and keep me as their personal pet and rapetoyBefore anyone asks, yes I'm a furfag
>>37737967Source please
>>37739845Furries literally help run and maintain the internet, and thus hellhole of a site so calm down2016 called, they want their furry hate back
>>37752545post proofalso, furry hate never died, it just transformed
>>37754134Don't need to lol, IT Jobs are literally filled with furries lmaoIf you know you know
>>37718781Yes, or to be more precise could have been.
>werewolfimagine creating a fictional character that becomes its own sexual fetish industry. that's quite an accomplishment.
>>37707189Why are they so sexy tho?
>>37752545Hellish and also true. Just like weird Star Trek sex perverts ran the internet from the internet from the 90's to the early 2010's, since then it's been furries all the way down. Super smart autists always become maladjusted freaks if you don't limit the media they consume. You expose them to a single thing that sparks a neuron in their brain incorrectly, and it's game over, you've got a 132 IQ dog fucking communist tech bro on your hands.
>>37755262W O U L D>>37755676ok vampirefag
>>37707189I wish modern media were depiction werewolves as more scarier and deadlier becouse, after all, werewolves, aside of being furries, they're monsters first and foremost in concept and I big fan of monsters in design wise. I even draw this mutant werewolf monstrosity chick from my childhood show that made me to see werewolves as an awesome beasts creatures.
>>37758545would
>>37737967this is way too much holyshit
>>37736723Who do you think made this thread lol
Werewolves would be so easy to defeat. Only really strong on full moons and vulnerable to silver bullets. Sorry to burst your bubble but any normal handgun can hold like 15 silver bullets in a magazine. Vampires with standard capacity mags would make quick work of werewolves with their superhuman reflexes combined with silver bullets.
>>37762117ok but imagine the sex with them though
>>37762130Okay you're right.
>>37762117The problem for werewolves isn't that they're hard to kill but that they're also people most of the time
>>37762149Yeah I was thinking more of werewolves that can change almost on demand but have buffs during a full-moon. But also, as the other anon mentioned, imagine the sex. Big werewolf juggs. I'll always be team vamp but damn.
>>37707189So... hypothetical question; would it be considered morally dubious to skin and tan the hide of a of werewolf and hang it on my wall, should I smite one in combat?
>>37707189Your damn picture made me jump.My gf and I were on a hill the other night drinking beers, cooking brauts and telling scary stories. When we got to the skinwalker stories, one of the motion sensor lights I bring along lit up with nothing there. So we packed up and left, we left most of the stuff up there except the phones and guns. That night I had a dream of a skinwalker crouching on top of a truck, it looked exactly like your pic (this is the first time I'm seeing this picture). In the dream I told my gf "come look at this", I closed the curtain and opened it again and the skinwalker was now face to face with me at the window. It stared at me and I had to force my head and eyes to stare back. Then I woke up and stayed up till sunrise.t. Navajo on Navajo Rez, northern AZ area
>>37737967goddamn
>>37752530MetalFoxT
>>37764147thx
>>37762172why not get vamp and werewolf to team up, and make vampire werewolf litters?
>>37762952You're a white kid who lives in like Pennsylvania or something stfu
>>37767198>white kidspotted the white-hating browniod/tranny / combination of both
>>37767341I'm also White. If I was any of those things I wouldn't shut the fuck up about it. You have to be retarded to think a Navajo is doing anything but huffing gasoline. If there is a single Navajo who uses 4chan it's not that guy. There's probably like ten Navajo in the entire country who know what 4chan even is.
For me it's 10-13ft wolf-folk ayys that eat bad guy lizard ayys, just like the buggy muck muck ayys do
>>37768284based based basedso fucking based
>>37766917Hey if it works then why not?
>>37768284Weird that there's no dog aliens right. There's cat aliens and bug aliens, bug no dogs? I guess dogs kinda look too terrestrial.
>>37771029bro let him in, he's just a little wet and cold
>>37707189
>>37771039Would you warm him up?
AwooooWurwulbes of LondiAwoooo
>>37773098yea of course, get the were-homie in the backseat, feed him some jerky, i dont mind wet dog smell, we good, if he wanna nap, he can nap
>>37707189There's a thread on /trash/ some of you guys would love. A thread posted once every month at the time of the full moon.>>65116764
>>37711695any werewolf movie recommendation?imo dog soldiers was a better movie than predator
>>37707189Gen A ruined this board.
>>37708407If you were an actual woman I'd gladly fuck your whore brains out. But you are a disgusting tranny. So I only bite you dead.
>>37707189Werewolf husband wishing thread
>>37707655Tell me more anon, I tried blasting your sequence but got nothing.
>>37777861Gay guys exist, anon.
gayest thread on 4chan rn
>>37778512you ever lurk /trash/?>captcha: m2m ayyfucking kek, never mind, you right
I saw a werewolf drinking a pina colada at Trader Vic’s
>>37781269pic for proof
Awoooooooooooooooooooooooooooooooooooooooooooooooooooooooo woooooooo woooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo
>>37777968Gay guys yes, gay werewolves no. I think one of the appeals of the werewolf is pure nature levels of animal lust that must be satisfied by ravaging a female mate. It is very interesting from a psychology perspective. I personally think it bellies frustration and a bit of insecurity with human mating. Its this complicated dance with lots of emotions and rules and entanglements when a lot of guys just wish they could FUCK and fuck well. Get rid of the bullshit and let nature take its course, and of course being a 7ft tall beast with a massive cock helps as well because in practice most of us really are 2 pump chumps with small cocks. Or maybe these are just my feelings.
>>37783927>Or maybe these are just my feelings.It's 100% this.
>>37707189Posting this absolute classic https://m.youtube.com/watch?v=1XALVTzMOeQ
>>37783302awooooooooooooooooooooooo
I heard him howling around my kitchen door, but I didn’t let him in
>>37707189that i such a fucking bad costume holy fuck lmao!
>>37707189Werewolves were always a disgusting fetish for furries. Why the fuck would anyone ever want to become a foul smelling ugly hairy beast, and lose your mind every full moon?.When you can be a insanely strong. peak magnetic and beautiful vampire with superhuman abilities, and have mind control powers in trade for an allergy to sun which you can cover with sunblock or umbrella.Literally zero downsides to being a vamp.Also;Vampires ruleWerefags drool.
>>37786093Vampires are unironically more gay than most(if not all) mythical creatures.